Transcript: Human NM_006549.3

Homo sapiens calcium/calmodulin dependent protein kinase kinase 2 (CAMKK2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
CAMKK2 (10645)
Length:
5620
CDS:
830..2596

Additional Resources:

NCBI RefSeq record:
NM_006549.3
NBCI Gene record:
CAMKK2 (10645)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146344 ACGTGGTGAGACTCCACTGT pXPR_003 CGG 435 25% 2 0.8196 CAMKK2 CAMKK2 76697
2 BRDN0001146379 TGTTCGAACTGGTCAACCAA pXPR_003 GGG 813 46% 8 0.5477 CAMKK2 CAMKK2 76699
3 BRDN0001145732 GAGACAGCTTGCGACCGGAG pXPR_003 AGG 284 16% 2 0.2847 CAMKK2 CAMKK2 76696
4 BRDN0001145125 TGGAAGGTTTGATGTCACGG pXPR_003 TGG 932 53% 10 0.0643 CAMKK2 CAMKK2 76698
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196992 GCAAAGAGGACGCCCATAATT pLKO.1 4910 3UTR 100% 15.000 21.000 N CAMKK2 n/a
2 TRCN0000195473 CCCGATGCTTCTGTTTCATTC pLKO.1 5411 3UTR 100% 10.800 15.120 N CAMKK2 n/a
3 TRCN0000363096 TCGTCAAGTTGGCCTACAATG pLKO_005 1362 CDS 100% 10.800 15.120 N CAMKK2 n/a
4 TRCN0000002301 CGACCCTTTCTACTATGCATT pLKO.1 5433 3UTR 100% 4.950 6.930 N CAMKK2 n/a
5 TRCN0000002300 AGTCAAACACATTCCCAGCTT pLKO.1 2251 CDS 100% 2.640 3.696 N CAMKK2 n/a
6 TRCN0000363122 ATCGTCATCTCTGGTTATTTG pLKO_005 2709 3UTR 100% 13.200 9.240 N CAMKK2 n/a
7 TRCN0000363121 GCCATGGGTGTGACACTATAC pLKO_005 1952 CDS 100% 10.800 7.560 N CAMKK2 n/a
8 TRCN0000002299 GTGAAGACCATGATACGTAAA pLKO.1 2288 CDS 100% 10.800 7.560 N CAMKK2 n/a
9 TRCN0000194684 CAATACCTACTATGCAATGAA pLKO.1 1390 CDS 100% 5.625 3.938 N CAMKK2 n/a
10 TRCN0000002297 CGAGCGGATCATGTGTTTACA pLKO.1 2005 CDS 100% 5.625 3.938 N CAMKK2 n/a
11 TRCN0000002298 CCGTTTCTACTTCCAGGATCT pLKO.1 1696 CDS 100% 4.050 2.835 N CAMKK2 n/a
12 TRCN0000199090 CCTCTCATCCTTGAGCATCCA pLKO.1 946 CDS 100% 2.640 1.848 N CAMKK2 n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 165 5UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 165 5UTR 100% 4.950 2.475 Y C19orf31 n/a
15 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 163 5UTR 100% 4.950 2.475 Y ERN2 n/a
16 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 163 5UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 163 5UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489407 TCATTGGCTCTTTCTTGGTCAGCC pLX_317 18.3% 91.8% 87.1% V5 (many diffs) n/a
2 TRCN0000489004 CTGAGTCACCCCACTTCCGCACTA pLX_317 17.4% 91.8% 87.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000491777 CTGATCGGTCACTTAGGGTCTCAT pLX_317 27.7% 84.5% 79.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000474789 TAATACCAGACATGCCCCAAAATT pLX_317 64.5% 32.3% 3.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV