Construct: ORF TRCN0000489615
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020331.1_s317c1
- DNA Barcode:
- TTGCACTTGCCTACGTGGGCGCCT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- ACVR1B (91)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489615
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 91 | ACVR1B | activin A receptor type 1B | NM_004302.5 | 100% | 100% | |
| 2 | human | 91 | ACVR1B | activin A receptor type 1B | NM_020328.4 | 92.4% | 92.3% | 812_934del |
| 3 | human | 91 | ACVR1B | activin A receptor type 1B | NM_020327.3 | 89.7% | 89.7% | 0_1ins156 |
| 4 | human | 91 | ACVR1B | activin A receptor type 1B | XM_017020201.2 | 75% | 75.2% | 1137_1139delGAGinsA;1141C>A;1143_1144ins374 |
| 5 | human | 91 | ACVR1B | activin A receptor type 1B | XM_011538966.3 | 69.4% | 69.4% | (many diffs) |
| 6 | human | 91 | ACVR1B | activin A receptor type 1B | XM_011538967.3 | 59.1% | 55.5% | (many diffs) |
| 7 | mouse | 11479 | Acvr1b | activin A receptor, type 1B | NM_007395.3 | 90.8% | 98.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1587
- ORF length:
- 1515
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcggag tcggccggag cctcctcctt cttccccctt gttgtcctcc 121 tgctcgccgg cagcggcggg tccgggcccc ggggggtcca ggctctgctg tgtgcgtgca 181 ccagctgcct ccaggccaac tacacgtgtg agacagatgg ggcctgcatg gtttccattt 241 tcaatctgga tgggatggag caccatgtgc gcacctgcat ccccaaagtg gagctggtcc 301 ctgccgggaa gcccttctac tgcctgagct cggaggacct gcgcaacacc cactgctgct 361 acactgacta ctgcaacagg atcgacttga gggtgcccag tggtcacctc aaggagcctg 421 agcacccgtc catgtggggc ccggtggagc tggtaggcat catcgccggc ccggtgttcc 481 tcctgttcct catcatcatc attgttttcc ttgtcattaa ctatcatcag cgtgtctatc 541 acaaccgcca gagactggac atggaagatc cctcatgtga gatgtgtctc tccaaagaca 601 agacgctcca ggatcttgtc tacgatctct ccacctcagg gtctggctca gggttacccc 661 tctttgtcca gcgcacagtg gcccgaacca tcgttttaca agagattatt ggcaagggtc 721 ggtttgggga agtatggcgg ggccgctgga ggggtggtga tgtggctgtg aaaatattct 781 cttctcgtga agaacggtct tggttcaggg aagcagagat ataccagacg gtcatgctgc 841 gccatgaaaa catccttgga tttattgctg ctgacaataa agataatggc acctggacac 901 agctgtggct tgtttctgac tatcatgagc acgggtccct gtttgattat ctgaaccggt 961 acacagtgac aattgagggg atgattaagc tggccttgtc tgctgctagt gggctggcac 1021 acctgcacat ggagatcgtg ggcacccaag ggaagcctgg aattgctcat cgagacttaa 1081 agtcaaagaa cattctggtg aagaaaaatg gcatgtgtgc catagcagac ctgggcctgg 1141 ctgtccgtca tgatgcagtc actgacacca ttgacattgc cccgaatcag agggtgggga 1201 ccaaacgata catggcccct gaagtacttg atgaaaccat taatatgaaa cactttGACT 1261 CCTTTAAATG TGCTGATATT TATGCCCTCG GGCTTGTATA TTGGGAGATT GCTCGAAGAT 1321 GCAATTCTGG AGGAGTCCAT GAAGAATATC AGCTGCCATA TTACGACTTA GTGCCCTCTG 1381 ACCCTTCCAT TGAGGAAATG CGAAAGGTTG TATGTGATCA GAAGCTGCGT CCCAACATCC 1441 CCAACTGGTG GCAGAGTTAT GAGGCACTGC GGGTGATGGG GAAGATGATG CGAGAGTGTT 1501 GGTATGCCAA CGGCGCAGCC CGCCTGACGG CCCTGCGCAT CAAGAAGACC CTCTCCCAGC 1561 TCAGCGTGCA GGAAGACGTG AAGATCTGAG ACCCAGCTTT CTTGTACAAA GTGGTTGATA 1621 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1681 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATTGCA 1741 CTTGCCTACG TGGGCGCCTA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1801 tgaaagatt