Transcript: Human NM_020328.4

Homo sapiens activin A receptor type 1B (ACVR1B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ACVR1B (91)
Length:
4654
CDS:
46..1686

Additional Resources:

NCBI RefSeq record:
NM_020328.4
NBCI Gene record:
ACVR1B (91)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144965 ACTTGACTCAGGTCACCTCA pXPR_003 AGG 337 21% 3 0.4297 ACVR1B ACVR1B 76680
2 BRDN0001146629 CCGGTTCAGATAATCAAACA pXPR_003 GGG 994 61% 6 0.3371 ACVR1B ACVR1B 76679
3 BRDN0001146179 AAGAGATTATTGGCAAGGGT pXPR_003 CGG 645 39% 4 0.2875 ACVR1B ACVR1B 76681
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020328.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195368 CCGTTCTTACGTCGCCATAAA pLKO.1 4436 3UTR 100% 13.200 18.480 N ACVR1B n/a
2 TRCN0000196874 GCCAATTTACTGGCCACTAAT pLKO.1 4004 3UTR 100% 13.200 18.480 N ACVR1B n/a
3 TRCN0000226395 ACTATCATCAGCGTGTCTATC pLKO_005 494 CDS 100% 10.800 15.120 N ACVR1B n/a
4 TRCN0000195680 CTACTGCAACAGGATCGACTT pLKO.1 342 CDS 100% 4.050 5.670 N ACVR1B n/a
5 TRCN0000195389 CCGGTACACAGTGACAATTGA pLKO.1 1053 CDS 100% 5.625 4.500 N ACVR1B n/a
6 TRCN0000001812 AGCAGAGATATACCAGACGGT pLKO.1 786 CDS 100% 0.660 0.528 N ACVR1B n/a
7 TRCN0000226398 CCTAACCTTTGGGCCAATTTA pLKO_005 3992 3UTR 100% 15.000 10.500 N ACVR1B n/a
8 TRCN0000197057 GCAGAACCTTGGCGGTTTATA pLKO.1 4098 3UTR 100% 15.000 10.500 N ACVR1B n/a
9 TRCN0000226396 GTACTTGATGAAACCATTAAT pLKO_005 1321 CDS 100% 15.000 10.500 N ACVR1B n/a
10 TRCN0000355763 ACGGGTCCCTGTTTGATTATC pLKO_005 1028 CDS 100% 13.200 9.240 N ACVR1B n/a
11 TRCN0000194920 CTCCTTTAAATGTGCTGATAT pLKO.1 1356 CDS 100% 13.200 9.240 N ACVR1B n/a
12 TRCN0000196765 GAATTGCTCATCGAGACTTAA pLKO.1 1157 CDS 100% 13.200 9.240 N ACVR1B n/a
13 TRCN0000226397 TTATGCCCTCGGGCTTGTATA pLKO_005 1377 CDS 100% 13.200 9.240 N ACVR1B n/a
14 TRCN0000355762 TTCAGGGAAGCAGAGATATAC pLKO_005 778 CDS 100% 13.200 9.240 N ACVR1B n/a
15 TRCN0000010152 TGTGGCTTGTTTCTGACTATC pLKO.1 1001 CDS 100% 10.800 7.560 N ACVR1B n/a
16 TRCN0000001810 CCACTGCTGCTACACTGACTA pLKO.1 324 CDS 100% 4.950 3.465 N ACVR1B n/a
17 TRCN0000010160 CCACTGCTGCTACACTGACTA pLKO.1 324 CDS 100% 4.950 3.465 N ACVR1B n/a
18 TRCN0000001813 CCTTGTCATTAACTATCATCA pLKO.1 483 CDS 100% 4.950 3.465 N ACVR1B n/a
19 TRCN0000196244 GCTGCCATATTACGACTTAGT pLKO.1 1449 CDS 100% 4.950 3.465 N ACVR1B n/a
20 TRCN0000001811 GCTGTGGCTTGTTTCTGACTA pLKO.1 999 CDS 100% 4.950 3.465 N ACVR1B n/a
21 TRCN0000010159 GGGCTTGTATATTGGGAGATT pLKO.1 1387 CDS 100% 4.950 3.465 N ACVR1B n/a
22 TRCN0000010151 GGGAAGCAGAGATATACCAGA pLKO.1 782 CDS 100% 2.640 1.848 N ACVR1B n/a
23 TRCN0000218047 AGATTGCTCGAAGATGCAATT pLKO_005 1403 CDS 100% 1.080 0.756 N ACVR1B n/a
24 TRCN0000196291 GTCAGCATATCTTAGGTATAT pLKO.1 3074 3UTR 100% 13.200 7.920 N ACVR1B n/a
25 TRCN0000001814 CGGGCTTGTATATTGGGAGAT pLKO.1 1386 CDS 100% 4.050 2.430 N ACVR1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020328.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00018 pDONR223 100% 92.4% 92.3% None 812_934del n/a
2 ccsbBroad304_00018 pLX_304 34.5% 92.4% 92.3% V5 812_934del n/a
3 TRCN0000465737 GGCATCCGACAGGTTCTCTTAACC pLX_317 26% 92.4% 92.3% V5 812_934del n/a
4 ccsbBroadEn_14528 pDONR223 0% 92.4% 92.3% None 812_934del n/a
5 ccsbBroad304_14528 pLX_304 26% 92.4% 92.3% V5 812_934del n/a
6 TRCN0000474947 CCGTTCGCCTTGATTCTTTCGACA pLX_317 24.5% 92.4% 92.3% V5 812_934del n/a
7 TRCN0000489615 TTGCACTTGCCTACGTGGGCGCCT pLX_317 22.2% 92.4% 92.3% V5 (not translated due to prior stop codon) 812_934del n/a
Download CSV