Construct: ORF TRCN0000489647
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020685.1_s317c1
- DNA Barcode:
- ACTGCTTCTTCCAGGGACTCAATC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CDK19 (23097)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489647
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23097 | CDK19 | cyclin dependent kinase 19 | NM_015076.5 | 100% | 100% | |
2 | human | 23097 | CDK19 | cyclin dependent kinase 19 | NM_001300960.2 | 91.2% | 91.2% | 513_514ins132 |
3 | human | 23097 | CDK19 | cyclin dependent kinase 19 | NM_001300963.1 | 88% | 88% | 0_1ins180 |
4 | human | 23097 | CDK19 | cyclin dependent kinase 19 | NM_001300964.2 | 88% | 88% | 0_1ins180 |
5 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_024446377.1 | 88% | 88% | 0_1ins180 |
6 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_024446378.1 | 88% | 88% | 0_1ins180 |
7 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_024446379.1 | 88% | 88% | 0_1ins180 |
8 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_024446380.1 | 88% | 88% | 0_1ins180 |
9 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_024446381.1 | 88% | 88% | 0_1ins180 |
10 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_017010587.2 | 87.6% | 86.6% | (many diffs) |
11 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_024446376.1 | 81.6% | 75.4% | (many diffs) |
12 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_011535631.2 | 77.7% | 61.8% | (many diffs) |
13 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_011535630.2 | 74.3% | 68.3% | (many diffs) |
14 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_005266871.3 | 73.1% | 71.3% | (many diffs) |
15 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_017010588.1 | 65.5% | 65.5% | 0_1ins519 |
16 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_011535632.2 | 49.5% | 41.8% | (many diffs) |
17 | mouse | 78334 | Cdk19 | cyclin-dependent kinase 19 | NM_001168304.1 | 90.1% | 96.4% | (many diffs) |
18 | mouse | 78334 | Cdk19 | cyclin-dependent kinase 19 | NM_198164.3 | 81.9% | 87.6% | (many diffs) |
19 | mouse | 78334 | Cdk19 | cyclin-dependent kinase 19 | NM_001291816.1 | 67.3% | 72.5% | (many diffs) |
20 | mouse | 78334 | Cdk19 | cyclin-dependent kinase 19 | XM_017314164.1 | 67.3% | 72.5% | (many diffs) |
21 | mouse | 78334 | Cdk19 | cyclin-dependent kinase 19 | NM_001291817.1 | 57.8% | 61.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1578
- ORF length:
- 1506
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggattat gatttcaagg cgaagctggc ggcggagcgg gagcgggtgg 121 aggatttgtt tgagtacgaa gggtgcaaag tgggacgcgg cacctacggt cacgtctaca 181 aggcgaggcg gaaagatgga aaagatgaaa aggaatatgc attgaagcaa attgaaggca 241 caggaatatc catgtcggct tgtagagaga ttgcactttt gcgagaattg aagcacccta 301 atgtgattgc attgcagaag gtgttccttt ctcacagtga caggaaggta tggctgctgt 361 ttgattatgc agagcatgac ttgtggcata ttattaagtt tcaccgtgca tcaaaagcaa 421 ataaaaagcc catgcagttg ccaagatcta tggttaaatc cttactttac cagattcttg 481 atggtatcca ttacctccat gcaaattggg tgcttcacag agacttgaaa ccagcaaata 541 tcctagtaat gggagaaggt cctgagaggg ggagagtcaa aatagctgac atgggttttg 601 ccagattatt caattctcct ctaaagccac tagcagattt ggatccagta gttgtgacat 661 tttggtatcg ggctccagaa cttttgcttg gtgcaaggca ttatacaaag gccattgata 721 tatgggcaat aggttgtata tttgctgaat tgttgacttc ggaacctatt tttcactgtc 781 gtcaggaaga tataaaaaca agcaatccct ttcatcatga tcaactggat cggatattta 841 gtgtcatggg gtttcctgca gataaagact gggaagatat tagaaagatg ccagaatatc 901 ccacacttca aaaagacttt agaagaacaa cgtatgccaa cagtagcctc ataaagtaca 961 tggagaaaca caaggtcaag cctgacagca aagtgttcct cttgcttcag aaactcctga 1021 ccatggatcc aaccaagaga attacctcgg agcaagctct gcaggatccc tattttcagg 1081 aggacccttt gccaacatta gatgtatttg ccggctgcca gattccatac cccaaacgag 1141 aattccttaa tgaagatgat ccTGAAGAAA AAGGTGACAA GAATCAGCAA CAGCAGCAGA 1201 ACCAGCATCA GCAGCCCACA GCCCCTCCAC AGCAGGCAGC AGCCCCTCCA CAGGCGCCCC 1261 CACCACAGCA GAACAGCACC CAGACCAACG GGACCGCAGG TGGGGCTGGG GCCGGGGTCG 1321 GGGGCACCGG AGCAGGGTTG CAGCACAGCC AGGACTCCAG CCTGAACCAG GTGCCTCCAA 1381 ACAAGAAGCC ACGGCTAGGG CCTTCAGGCG CAAACTCAGG TGGACCTGTG ATGCCCTCGG 1441 ATTATCAGCA CTCCAGTTCT CGCCTGAATT ACCAAAGCAG CGTTCAGGGA TCCTCTCAGT 1501 CCCAGAGCAC ACTTGGCTAC TCTTCCTCGT CTCAGCAGAG CTCACAGTAC CACCCATCTC 1561 ACCAGGCCCA CCGGTACTAG AACCCAGCTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1621 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1681 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAACTG CTTCTTCCAG 1741 GGACTCAATC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt