Transcript: Human XM_024446376.1

PREDICTED: Homo sapiens cyclin dependent kinase 19 (CDK19), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDK19 (23097)
Length:
6692
CDS:
336..2135

Additional Resources:

NCBI RefSeq record:
XM_024446376.1
NBCI Gene record:
CDK19 (23097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446376.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003143 ACCAGCAAATATCCTAGTAAT pLKO.1 1085 CDS 100% 13.200 18.480 N CDK19 n/a
2 TRCN0000197019 GCCAACAGTAGCCTCATAAAG pLKO.1 1491 CDS 100% 13.200 18.480 N CDK19 n/a
3 TRCN0000195069 CGTTCGTATTTATCTAGTTTC pLKO.1 2680 3UTR 100% 10.800 15.120 N CDK19 n/a
4 TRCN0000003140 GCTTGTAGAGAGATTGCACTT pLKO.1 813 CDS 100% 4.050 5.670 N CDK19 n/a
5 TRCN0000352638 GCTTGTAGAGAGATTGCACTT pLKO_005 813 CDS 100% 4.050 5.670 N CDK19 n/a
6 TRCN0000003144 AGGACTGATAGCTCTTCTTTA pLKO.1 2283 3UTR 100% 13.200 9.240 N CDK19 n/a
7 TRCN0000196528 GTATGGCTGCTGTTTGATTAT pLKO.1 903 CDS 100% 13.200 9.240 N CDK19 n/a
8 TRCN0000352698 GTATGGCTGCTGTTTGATTAT pLKO_005 903 CDS 100% 13.200 9.240 N CDK19 n/a
9 TRCN0000003141 GATATTAGAAAGATGCCAGAA pLKO.1 1431 CDS 100% 4.050 2.835 N CDK19 n/a
10 TRCN0000003142 GCGAGAATTGAAGCACCCTAA pLKO.1 836 CDS 100% 4.050 2.835 N CDK19 n/a
11 TRCN0000194732 CTTTCTAAACTGCCTAGTTTG pLKO.1 6356 3UTR 100% 1.080 0.756 N CDK19 n/a
12 TRCN0000196683 GCATGACTTGTGGCATATTAT pLKO.1 929 CDS 100% 15.000 9.000 N CDK19 n/a
13 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 4959 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446376.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15005 pDONR223 100% 81.9% 1.9% None (many diffs) n/a
2 ccsbBroad304_15005 pLX_304 0% 81.9% 1.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000470685 TTCAGCCAGAAATAAAATGGCCAT pLX_317 25.5% 81.9% 1.9% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489647 ACTGCTTCTTCCAGGGACTCAATC pLX_317 27.9% 81.6% 75.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV