Transcript: Mouse XM_017314164.1

PREDICTED: Mus musculus cyclin-dependent kinase 19 (Cdk19), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdk19 (78334)
Length:
5413
CDS:
253..1398

Additional Resources:

NCBI RefSeq record:
XM_017314164.1
NBCI Gene record:
Cdk19 (78334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314164.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360759 CTGTCGTCAGGAGGATATAAA pLKO_005 597 CDS 100% 15.000 21.000 N Cdk19 n/a
2 TRCN0000360758 TGATCAGTTAGATCGAATATT pLKO_005 639 CDS 100% 15.000 21.000 N Cdk19 n/a
3 TRCN0000360761 CCCGTTATGCCGTCGGATTAT pLKO_005 1246 CDS 100% 13.200 18.480 N Cdk19 n/a
4 TRCN0000360760 TTACCAAGATCCATGGTTAAA pLKO_005 259 CDS 100% 13.200 18.480 N Cdk19 n/a
5 TRCN0000023280 GCACCCTAATGTGATCGCATT pLKO.1 114 5UTR 100% 4.050 5.670 N Cdk19 n/a
6 TRCN0000023281 CGTCGGATTATCAGCATTCCA pLKO.1 1256 CDS 100% 3.000 4.200 N Cdk19 n/a
7 TRCN0000003143 ACCAGCAAATATCCTAGTAAT pLKO.1 351 CDS 100% 13.200 10.560 N CDK19 n/a
8 TRCN0000023283 CCCAACACTTCAGAAAGACTT pLKO.1 720 CDS 100% 4.950 3.465 N Cdk19 n/a
9 TRCN0000023279 CCTGCCAACATTAGATGTGTT pLKO.1 909 CDS 100% 4.950 3.465 N Cdk19 n/a
10 TRCN0000023282 CTGCTGTTTGACTATGCAGAA pLKO.1 175 5UTR 100% 4.050 2.835 N Cdk19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314164.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489647 ACTGCTTCTTCCAGGGACTCAATC pLX_317 27.9% 67.3% 72.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15005 pDONR223 100% 62.5% 3% None (many diffs) n/a
3 ccsbBroad304_15005 pLX_304 0% 62.5% 3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000470685 TTCAGCCAGAAATAAAATGGCCAT pLX_317 25.5% 62.5% 3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV