Construct: ORF TRCN0000489797
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021687.1_s317c1
- DNA Barcode:
- TTACCACTATACTGGCTATAGAAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- AXL (558)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489797
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 558 | AXL | AXL receptor tyrosine kinase | NM_001278599.1 | 65.3% | 1_649del;742C>T;1487A>G | |
2 | human | 558 | AXL | AXL receptor tyrosine kinase | NM_001699.6 | 46.2% | 1_1426del;1519C>T;2264A>G | |
3 | human | 558 | AXL | AXL receptor tyrosine kinase | NM_021913.5 | 45.7% | 1_1453del;1546C>T;2291A>G | |
4 | mouse | 26362 | Axl | AXL receptor tyrosine kinase | XM_006539993.2 | 46.5% | (many diffs) | |
5 | mouse | 26362 | Axl | AXL receptor tyrosine kinase | NM_001190975.1 | 45.9% | (many diffs) | |
6 | mouse | 26362 | Axl | AXL receptor tyrosine kinase | XM_006539992.2 | 45.9% | (many diffs) | |
7 | mouse | 26362 | Axl | AXL receptor tyrosine kinase | NM_001190974.1 | 41.3% | (many diffs) | |
8 | mouse | 26362 | Axl | AXL receptor tyrosine kinase | XM_006539991.3 | 41.3% | (many diffs) | |
9 | mouse | 26362 | Axl | AXL receptor tyrosine kinase | NM_009465.4 | 40.9% | (many diffs) | |
10 | mouse | 26362 | Axl | AXL receptor tyrosine kinase | XM_006539989.3 | 40.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 196
- ORF end:
- 199
- ORF length:
- 3
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggctttga accaacagtg gaaagaggtg aactggtagt caggtaccgc gtgcgcaagt 121 cctacagtcg tcggaccact gaagctacct tgaacagctt gggcatcagt gaagagctga 181 aggagaagct gcgggatgtg atggtggacc ggcacaaggt ggccctgggg aagactctgg 241 gagagggaga gtttggagct gtgatggaag gccagctcaa ccaggacgac tccatcctca 301 aggtggctgt gaagacgatg aagattgcca tctgcacgag gtcagagctg gaggatttcc 361 tgagtgaagc ggtctgcatg aaggaatttg accatcccaa cgtcatgagg ctcatcggtg 421 tctgtttcca gggttctgaa cgagagagct tcccagcacc tgtggtcatc ttacctttca 481 tgaaacatgg agacctacac agcttcctcc tctattcccg gctcggggac cagccagtgt 541 acctgcccac tcagatgcta gtgaagttca tggcagacat cgccagtggc atggagtatc 601 tgagtaccaa gagattcata caccgggacc tggcggccag gaactgcatg ctgaatgaga 661 acatgtccgt gtgtgtggcg gacttcgggc tctccaagaa gatctacaat ggggactact 721 accgccaggg acgtatcgcc aagatgccag tcaagtggat tgccattgag agtctagctg 781 accgtgtcta caccagcaag agcgatgtgt ggtccttcgg ggtgacaatg tgggagattg 841 ccacaagagg ccaaacccca tatccgggcg tggagaacag cgagatttat gactatctgc 901 gccggggaaa tcgcctgaag cagcctGCGG ACTGTCTGGA TGGACTGTAT GCCTTGATGT 961 CGCGGTGCTG GGAGCTAAAT CCCCAGGACC GGCCAAGTTT TACAGAGCTG CGGGAAGATT 1021 TGGAGAACAC ACTGAAGGCC TTGCCTCCTG CCCAGGAGCC TGACGAAATC CTCTATGTCA 1081 ACATGGATGA GGGTGGAGGT TATCCTGAAC CCCCTGGAGC TGCAGGAGGA GCTGACCCCC 1141 CAACCCAGCC AGACCCTAAG GATTCCTGTA GCTGCCTCAC TGCGGCTGAG GTCCATCCTG 1201 CTGGACGCTA TGTCCTCTGC CCTTCCACAA CCCCTAGCCC CGCTCAGCCT GCTGATAGGG 1261 GCTCCCCAGC AGCCCCAGGG CAGGAGGATG GTGCCTGAGA CCCAGCTTTC TTGTACAAAG 1321 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1381 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1441 ACGATTACCA CTATACTGGC TATAGAACAC GCGTTAAGTC gacaatcaac ctctggatta 1501 caaaatttgt gaaagatt