Transcript: Mouse NM_001190974.1

Mus musculus AXL receptor tyrosine kinase (Axl), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Axl (26362)
Length:
5057
CDS:
256..2895

Additional Resources:

NCBI RefSeq record:
NM_001190974.1
NBCI Gene record:
Axl (26362)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001190974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023309 CCCGAGGTACTTATGGATATA pLKO.1 1366 CDS 100% 13.200 18.480 N Axl n/a
2 TRCN0000322068 ACCTAAGGCTTCTAGACTTTA pLKO_005 3309 3UTR 100% 13.200 9.240 N Axl n/a
3 TRCN0000023311 GCTGTCTGCATGAAGGAATTT pLKO.1 1966 CDS 100% 13.200 9.240 N Axl n/a
4 TRCN0000023312 CCAGTCAAGTGGATTGCTATT pLKO.1 2344 CDS 100% 10.800 7.560 N Axl n/a
5 TRCN0000322131 CCAGTCAAGTGGATTGCTATT pLKO_005 2344 CDS 100% 10.800 7.560 N Axl n/a
6 TRCN0000023310 CGTCAAGGAAATCGGCTGAAA pLKO.1 2497 CDS 100% 4.950 3.465 N Axl n/a
7 TRCN0000322132 CGTCAAGGAAATCGGCTGAAA pLKO_005 2497 CDS 100% 4.950 3.465 N Axl n/a
8 TRCN0000023313 CAGATCCTAGAACTGGCTGAT pLKO.1 457 CDS 100% 4.050 2.835 N Axl n/a
9 TRCN0000322074 CAGATCCTAGAACTGGCTGAT pLKO_005 457 CDS 100% 4.050 2.835 N Axl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14546 pDONR223 0% 84.1% 86.9% None (many diffs) n/a
2 TRCN0000480014 GTACGCGAAGCTCCCAGGAGAAGC pLX_317 14% 84.1% 86.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroad304_14546 pLX_304 25.2% 78.1% 64.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489649 CTCCGAAGCTAATTCATGGTAGCA pLX_317 14.1% 84% 86.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489797 TTACCACTATACTGGCTATAGAAC pLX_317 30.5% 41.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV