Transcript: Human NM_001278599.1

Homo sapiens AXL receptor tyrosine kinase (AXL), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
AXL (558)
Length:
4128
CDS:
377..2257

Additional Resources:

NCBI RefSeq record:
NM_001278599.1
NBCI Gene record:
AXL (558)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278599.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000573 GCGGTCTGCATGAAGGAATTT pLKO.1 1328 CDS 100% 13.200 18.480 N AXL n/a
2 TRCN0000001038 GCGGTCTGCATGAAGGAATTT pLKO.1 1328 CDS 100% 13.200 18.480 N AXL n/a
3 TRCN0000000572 CTTTAGGTTCTTTGCTGCATT pLKO.1 3686 3UTR 100% 4.950 6.930 N AXL n/a
4 TRCN0000001037 CTTTAGGTTCTTTGCTGCATT pLKO.1 3686 3UTR 100% 4.950 6.930 N AXL n/a
5 TRCN0000000574 CGAAAGAAGGAGACCCGTTAT pLKO.1 995 CDS 100% 10.800 8.640 N AXL n/a
6 TRCN0000001039 CGAAAGAAGGAGACCCGTTAT pLKO.1 995 CDS 100% 10.800 8.640 N AXL n/a
7 TRCN0000342412 CGAAAGAAGGAGACCCGTTAT pLKO_005 995 CDS 100% 10.800 8.640 N AXL n/a
8 TRCN0000000575 CGAAATCCTCTATGTCAACAT pLKO.1 2023 CDS 100% 4.950 3.960 N AXL n/a
9 TRCN0000001040 CGAAATCCTCTATGTCAACAT pLKO.1 2023 CDS 100% 4.950 3.960 N AXL n/a
10 TRCN0000342414 CGAAATCCTCTATGTCAACAT pLKO_005 2023 CDS 100% 4.950 3.960 N AXL n/a
11 TRCN0000194971 CCTAAGCATCTAAGTTATAAG pLKO.1 3602 3UTR 100% 13.200 9.240 N AXL n/a
12 TRCN0000195353 CGTGGAGAACAGCGAGATTTA pLKO.1 1828 CDS 100% 13.200 9.240 N AXL n/a
13 TRCN0000342371 CGTGGAGAACAGCGAGATTTA pLKO_005 1828 CDS 100% 13.200 9.240 N AXL n/a
14 TRCN0000196945 GATTGCCATTGAGAGTCTAGC pLKO.1 1717 CDS 100% 4.050 2.835 N AXL n/a
15 TRCN0000352685 GATTGCCATTGAGAGTCTAGC pLKO_005 1717 CDS 100% 4.050 2.835 N AXL n/a
16 TRCN0000000576 GCTGTGAAGACGATGAAGATT pLKO.1 1265 CDS 100% 5.625 3.375 N AXL n/a
17 TRCN0000001041 GCTGTGAAGACGATGAAGATT pLKO.1 1265 CDS 100% 5.625 3.375 N AXL n/a
18 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2849 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278599.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14546 pDONR223 0% 70% 70% None 0_1ins804 n/a
2 TRCN0000480014 GTACGCGAAGCTCCCAGGAGAAGC pLX_317 14% 70% 70% V5 (not translated due to prior stop codon) 0_1ins804 n/a
3 ccsbBroad304_14546 pLX_304 25.2% 62.6% 46.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489649 CTCCGAAGCTAATTCATGGTAGCA pLX_317 14.1% 69.9% 69.9% V5 (not translated due to prior stop codon) 0_1ins804;742C>T;1487A>G n/a
5 TRCN0000489797 TTACCACTATACTGGCTATAGAAC pLX_317 30.5% 65.3% V5 (not translated due to prior stop codon) 1_649del;742C>T;1487A>G n/a
Download CSV