Construct: ORF TRCN0000489800
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021496.1_s317c1
- DNA Barcode:
- GTTCATACCTAGACATTCCAGATT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- FYN (2534)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489800
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_001370529.1 | 99.9% | 100% | 12G>A |
| 2 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_002037.5 | 99.9% | 100% | 12G>A |
| 3 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010650.1 | 99.9% | 100% | 12G>A |
| 4 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010651.1 | 99.9% | 100% | 12G>A |
| 5 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010652.1 | 99.9% | 100% | 12G>A |
| 6 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010653.1 | 99.9% | 100% | 12G>A |
| 7 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_153047.4 | 93.6% | 94.4% | (many diffs) |
| 8 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_153048.3 | 89.6% | 89.7% | 12G>A;696_697ins165 |
| 9 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_005266892.4 | 89.6% | 89.7% | 12G>A;696_697ins165 |
| 10 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010655.2 | 56.1% | 53.7% | (many diffs) |
| 11 | mouse | 14360 | Fyn | Fyn proto-oncogene | NM_001122893.1 | 93.1% | 99.4% | (many diffs) |
| 12 | mouse | 14360 | Fyn | Fyn proto-oncogene | XM_006512539.3 | 93.1% | 99.4% | (many diffs) |
| 13 | mouse | 14360 | Fyn | Fyn proto-oncogene | XM_006512540.3 | 93.1% | 99.4% | (many diffs) |
| 14 | mouse | 14360 | Fyn | Fyn proto-oncogene | XM_011243117.2 | 93.1% | 99.4% | (many diffs) |
| 15 | mouse | 14360 | Fyn | Fyn proto-oncogene | NM_001122892.1 | 87.6% | 93.8% | (many diffs) |
| 16 | mouse | 14360 | Fyn | Fyn proto-oncogene | NM_008054.2 | 87.6% | 93.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1680
- ORF length:
- 1611
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gggctgtgta caatgtaagg ataaagaagc aacaaaactg acggaggaga 121 gggacggcag cctgaaccag agctctgggt accgctatgg cacagacccc acccctcagc 181 actaccccag cttcggtgtg acctccatcc ccaactacaa caacttccac gcagccgggg 241 gccaaggact caccgtcttt ggaggtgtga actcttcgtc tcatacgggg accttgcgta 301 cgagaggagg aacaggagtg acactctttg tggcccttta tgactatgaa gcacggacag 361 aagatgacct gagttttcac aaaggagaaa aatttcaaat attgaacagc tcggaaggag 421 attggtggga agcccgctcc ttgacaactg gagagacagg ttacattccc agcaattatg 481 tggctccagt tgactctatc caggcagaag agtggtactt tggaaaactt ggccgaaaag 541 atgctgagcg acagctattg tcctttggaa acccaagagg tacctttctt atccgcgaga 601 gtgaaaccac caaaggtgcc tattcacttt ctatccgtga ttgggatgat atgaaaggag 661 accatgtcaa acattataaa attcgcaaac ttgacaatgg tggatactac attaccaccc 721 gggcccagtt tgaaacactt cagcagcttg tacaacatta ctcagagaga gctgcaggtc 781 tctgctgccg cctagtagtt ccctgtcaca aagggatgcc aaggcttacc gatctgtctg 841 tcaaaaccaa agatgtctgg gaaatccctc gagaatccct gcagttgatc aagagactgg 901 gaaatgggca gtttggggaa gtatggatgg gtacctggaa tggaaacaca aaagtagcca 961 taaagactct taaaccaggc acaatgtccc ccgaatcatt ccttgaggaa gcgcagatca 1021 tgaagaagct gaagcacgac aagctggtcc agctctatgc agtggtgtct gaggagccca 1081 tctacatcgt caccgagtat atgaacaaag gaagtttact ggatttctta aaagatggag 1141 aaggaagagc tctgaaatta ccaaatcttg tggacatggc agcacaggtg gctgcaggaa 1201 tggcttacat cgagcgcatg aattatatcc atagagatct gcgatcagca aacattctag 1261 tggggaatgg actcatatgc aagattgctg acttcGGATT GGCCCGATTG ATAGAAGACA 1321 ATGAGTACAC AGCAAGACAA GGTGCAAAGT TCCCCATCAA GTGGACGGCC CCCGAGGCAG 1381 CCCTGTACGG GAGGTTCACA ATCAAGTCTG ACGTGTGGTC TTTTGGAATC TTACTCACAG 1441 AGCTGGTCAC CAAAGGAAGA GTGCCATACC CAGGCATGAA CAACCGGGAG GTGCTGGAGC 1501 AGGTGGAGCG AGGCTACAGG ATGCCCTGCC CGCAGGACTG CCCCATCTCT CTGCATGAGC 1561 TCATGATCCA CTGCTGGAAA AAGGACCCTG AAGAACGCCC CACTTTTGAG TACTTGCAGA 1621 GCTTCCTGGA AGACTACTTT ACCGCGACAG AGCCCCAGTA CCAACCTGGT GAAAACCTGT 1681 AATAGGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1741 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1801 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGTTCATACC TAGACATTCC AGATTACGCG 1861 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt