Construct: ORF TRCN0000489805
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020856.1_s317c1
- DNA Barcode:
- AGGATTATCCTTTGAGTTTGTATC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR176 (11245)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489805
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 11245 | GPR176 | G protein-coupled receptor 176 | NM_001271854.2 | 99.9% | 99.8% | 230A>G |
| 2 | human | 11245 | GPR176 | G protein-coupled receptor 176 | NM_007223.3 | 97.1% | 96.5% | (many diffs) |
| 3 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_011521167.3 | 89.6% | 84.6% | (many diffs) |
| 4 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_011521168.3 | 89.6% | 84.6% | (many diffs) |
| 5 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021873.2 | 89.6% | 84.6% | (many diffs) |
| 6 | human | 11245 | GPR176 | G protein-coupled receptor 176 | NM_001271855.2 | 87.7% | 86.9% | (many diffs) |
| 7 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021874.2 | 68.4% | 68.4% | 0_1ins486 |
| 8 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021875.2 | 68.4% | 68.4% | 0_1ins486 |
| 9 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021876.1 | 68.4% | 68.4% | 0_1ins486 |
| 10 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021877.1 | 68.4% | 68.4% | 0_1ins486 |
| 11 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021878.2 | 68.4% | 68.4% | 0_1ins486 |
| 12 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_024449835.1 | 68.4% | 68.4% | 0_1ins486 |
| 13 | mouse | 381413 | Gpr176 | G protein-coupled receptor 176 | NM_201367.3 | 84.1% | 86.6% | (many diffs) |
| 14 | mouse | 381413 | Gpr176 | G protein-coupled receptor 176 | XM_011239648.2 | 75% | 78.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1614
- ORF length:
- 1542
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgggacat aacgggagct ggatctctcc aaatgccagc gagccgcaca 121 acgcgtccgg cgccgaggct gcgggtgtga accgcagcgc gctcggggag ttcggcgagg 181 cgcagctgta ccgccagttc accaccaccg tgcaggtcgt catcttcata ggctcgctgc 241 tcgagtttgg caacatggag gtcactagaa aacttgataa gagcagactg cctgggatta 301 ggttcattaa aaacctggcc tgctcgggga tttgtgccag cctggtctgt gtgcccttcg 361 acatcatcct cagcaccagt cctcactgtt gctggtggat ctacaccatg ctcttctgca 421 aggtcgtcaa atttttgcac aaagtattct gctctgtgac catcctcagc ttccctgcta 481 ttgctttgga caggtactac tcagtcctct atccactgga gaggaaaata tctgatgcca 541 agtcccgtga actggtgatg tacatctggg cccatgcagt ggtggccagt gtccctgtgt 601 ttgcagtaac caatgtggct gacatctatg ccacgtccac ctgcacggaa gtctggagca 661 actccttggg ccacctggtg tacgttctgg tgtataacat caccacggtc attgtgcctg 721 tggtggtggt gttcctcttc ttgatactga tccgacgggc cctgagtgcc agccagaaga 781 agaaggtcat catagcagcg ctccggaccc cacagaacac catctctatt ccctatgcct 841 cccagcggga ggccgagctg cacgccaccc tgctctccat ggtgatggtc ttcatcttgt 901 gtagcgtgcc ctatgccacc ctggtcgtct accagactgt gctcaatgtc cctgacactt 961 ccgtcttctt gctgctcact gctgtttggc tgcccaaagt ctccctgctg gcaaaccctg 1021 ttctctttct tactgtgaac aaatctgtcc gcaagtgctt gatagggacc ctggtgcaac 1081 tacaccaccg gtacagtcgc cgtaatgtgg tcagtacagg gagtggcatg gctgaggcca 1141 gcctggaacc cagcatacgc tcgggtagcc agctcctgga gatgttccac attgggcagc 1201 agcagatctt taagcccaca gaggatgagg aagagagtga ggccaagtac attggcTCAG 1261 CTGACTTCCA GGCCAAGGAG ATATTTAGCA CCTGCCTGGA GGGAGAGCAG GGGCCACAGT 1321 TTGCGCCCTC TGCCCCACCC CTGAGCACAG TGGACTCTGT ATCCCAGGTG GCACCGGCAG 1381 CCCCTGTGGA ACCTGAAACA TTCCCTGATA AGTATTCCCT GCAGTTTGGC TTTGGGCCTT 1441 TTGAGTTGCC TCCTCAGTGG CTCTCAGAGA CCCGAAACAG CAAGAAGCGG CTGCTTCCCC 1501 CCTTGGGCAA CACCCCAGAA GAGCTGATCC AGACAAAGGT GCCCAAGGTA GGCAGGGTGG 1561 AGCGGAAGAT GAGCAGAAAC AATAAAGTGA GCATTTTTCC AAAGGTGGAT TCCTAGGACC 1621 CAGCTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1681 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1741 ATATATCTTG TGGAAAGGAC GAAGGATTAT CCTTTGAGTT TGTATCACGC GTTAAGTCga 1801 caatcaacct ctggattaca aaatttgtga aagatt