Construct: ORF TRCN0000489823
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021187.1_s317c1
- DNA Barcode:
- CTTGACCTCCTCCCAGTACTTTTG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NPR3 (4883)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489823
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001204375.2 | 100% | 100% | |
2 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_000908.4 | 99.8% | 99.6% | 1426_1427insCAG |
3 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | XM_017009492.2 | 92.4% | 92.4% | 768_769ins123 |
4 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001363652.2 | 58.6% | 52.8% | (many diffs) |
5 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001204376.1 | 58.4% | 52.4% | (many diffs) |
6 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | XM_011514047.2 | 57.2% | 53.3% | (many diffs) |
7 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001364458.2 | 54.4% | 53% | (many diffs) |
8 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | XM_011514049.3 | 52.1% | 52.1% | 0_1ins777 |
9 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001364460.2 | 50.8% | 43.1% | (many diffs) |
10 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | XM_011514050.2 | 49.3% | 47.3% | (many diffs) |
11 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | NM_008728.2 | 86.5% | 90.7% | (many diffs) |
12 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | NM_001039181.1 | 86.3% | 90.3% | (many diffs) |
13 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | XM_006520028.2 | 46.7% | 49.3% | (many diffs) |
14 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | XM_006520030.3 | 46.7% | 49.3% | (many diffs) |
15 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | XM_006520031.2 | 46.7% | 49.3% | (many diffs) |
16 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | XM_017316493.1 | 46.7% | 49.3% | (many diffs) |
17 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | NM_001286395.1 | 46.5% | 48.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1695
- ORF length:
- 1623
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgccgtct ctgctggtgc tcactttctc cccgtgcgta ctactcggct 121 gggcgttgct ggccggcggc accggtggcg gtggcgttgg cggcggcggc ggtggcgcgg 181 gcataggcgg cggacgccag gagagagagg cgctgccgcc acagaagatc gaggtgctgg 241 tgttactgcc ccaggatgac tcgtacttgt tttcactcac ccgggtgcgg ccggccatcg 301 agtatgctct gcgcagcgtg gagggcaacg ggactgggag gcggcttctg ccgccgggca 361 ctcgcttcca ggtggcttac gaggattcag actgtgggaa ccgtgcgctc ttcagcttgg 421 tggaccgcgt ggcggcggcg cggggcgcca agccagacct tatcctgggg ccagtgtgcg 481 agtatgcagc agcgccagtg gcccggcttg catcgcactg ggacctgccc atgctgtcgg 541 ctggggcgct ggccgctggc ttccagcaca aggactctga gtactcgcac ctcacgcgcg 601 tggcgcccgc ctacgccaag atgggcgaga tgatgctcgc cctgttccgc caccaccact 661 ggagccgcgc tgcactggtc tacagcgacg acaagctgga gcggaactgc tacttcaccc 721 tcgagggggt ccacgaggtc ttccaggagg agggtttgca cacgtccatc tacagtttcg 781 acgagaccaa agacttggat ctggaagaca tcgtgcgcaa tatccaggcc agtgagagag 841 tggtgatcat gtgtgcgagc agtgacacca tccggagcat catgctggtg gcgcacaggc 901 atggcatgac cagtggagac tacgccttct tcaacattga gctcttcaac agctcttcct 961 atggagatgg ctcatggaag agaggagaca aacacgactt tgaagctaag caagcatact 1021 cgtccctcca gacagtcact ctactgagga cagtgaaacc tgagtttgag aagttttcca 1081 tggaggtgaa aagttcagtt gagaaacaag ggctcaatat ggaggattac gttaacatgt 1141 ttgttgaagg attccacgat gccatcctcc tctacgtctt ggctctacat gaagtactca 1201 gagctggtta cagcaaaaag gatggaggga aaattataca gcagacttgg aacagaacat 1261 ttgaaggtat cgccgggcag gtgtccatag atgccaacgg agaccgatat ggggatttct 1321 ctgtgattgc catgactgat gtggaggcgg gcacccagga ggttattggt gattattttg 1381 gaaaagaagg tcgttttgaa atgcggccga atgtcaaata tccttggggc cctttaaaaC 1441 TGAGAATAGA TGAAAACCGA ATTGTAGAGC ATACAAACAG CTCTCCCTGC AAATCATCAG 1501 GTGGCCTAGA AGAATCGGCA GTGACAGGAA TTGTCGTGGG GGCTTTACTA GGAGCTGGCT 1561 TGCTAATGGC CTTCTACTTT TTCAGGAAGA AATACAGAAT AACCATTGAG AGGCGAACCC 1621 AGCAAGAAGA AAGTAACCTT GGAAAACATC GGGAATTACG GGAAGATTCC ATCAGATCCC 1681 ATTTTTCAGT AGCTTAAGAC CCAGCTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1741 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1801 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACTTGACC TCCTCCCAGT 1861 ACTTTTGACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt