Transcript: Human XM_011514047.2

PREDICTED: Homo sapiens natriuretic peptide receptor 3 (NPR3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPR3 (4883)
Length:
1396
CDS:
12..968

Additional Resources:

NCBI RefSeq record:
XM_011514047.2
NBCI Gene record:
NPR3 (4883)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357661 CAATATGGAGGATTACGTTAA pLKO_005 386 CDS 100% 10.800 15.120 N NPR3 n/a
2 TRCN0000009204 CCGAATTGTAGAGCATACAAA pLKO.1 728 CDS 100% 0.563 0.450 N NPR3 n/a
3 TRCN0000357587 AGGAGGTTATTGGTGATTATT pLKO_005 628 CDS 100% 15.000 10.500 N NPR3 n/a
4 TRCN0000357659 TATCGTGTCACTCTGTTAAAT pLKO_005 1185 3UTR 100% 15.000 10.500 N NPR3 n/a
5 TRCN0000009202 CCAGGAGGTTATTGGTGATTA pLKO.1 626 CDS 100% 13.200 9.240 N NPR3 n/a
6 TRCN0000357660 GATGCCAACGGAGACCGATAT pLKO_005 561 CDS 100% 10.800 7.560 N NPR3 n/a
7 TRCN0000009201 CCTGAGATTCTTTAAGGAGAT pLKO.1 997 3UTR 100% 4.050 2.835 N NPR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488510 AAGGGAAACGTAGGGATGCTCTCT pLX_317 23.3% 57.2% 53.3% V5 (many diffs) n/a
2 TRCN0000489823 CTTGACCTCCTCCCAGTACTTTTG pLX_317 16.2% 57.2% 53.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_14719 pDONR223 52.4% 57.1% .5% None (many diffs) n/a
4 ccsbBroad304_14719 pLX_304 0% 57.1% .5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000476668 CGTGTTGAAGCGCTGCGCAGTTTG pLX_317 27.1% 57.1% .5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV