Transcript: Human NM_001364458.2

Homo sapiens natriuretic peptide receptor 3 (NPR3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
NPR3 (4883)
Length:
6294
CDS:
14..919

Additional Resources:

NCBI RefSeq record:
NM_001364458.2
NBCI Gene record:
NPR3 (4883)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364458.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357661 CAATATGGAGGATTACGTTAA pLKO_005 337 CDS 100% 10.800 15.120 N NPR3 n/a
2 TRCN0000418887 GCATAGATCTCATGCAGATAG pLKO_005 4336 3UTR 100% 10.800 8.640 N NPR3 n/a
3 TRCN0000009204 CCGAATTGTAGAGCATACAAA pLKO.1 679 CDS 100% 0.563 0.450 N NPR3 n/a
4 TRCN0000357587 AGGAGGTTATTGGTGATTATT pLKO_005 579 CDS 100% 15.000 10.500 N NPR3 n/a
5 TRCN0000357659 TATCGTGTCACTCTGTTAAAT pLKO_005 1136 3UTR 100% 15.000 10.500 N NPR3 n/a
6 TRCN0000417372 TCTACAGACCCTACTATAATT pLKO_005 4051 3UTR 100% 15.000 10.500 N NPR3 n/a
7 TRCN0000009202 CCAGGAGGTTATTGGTGATTA pLKO.1 577 CDS 100% 13.200 9.240 N NPR3 n/a
8 TRCN0000421373 GAGATCAAATAGAGTATTATG pLKO_005 4442 3UTR 100% 13.200 9.240 N NPR3 n/a
9 TRCN0000418303 GGATGCAGACATGAGAGTAAA pLKO_005 4538 3UTR 100% 13.200 9.240 N NPR3 n/a
10 TRCN0000412630 GTTGGTAATGAGCTGAATTTC pLKO_005 4645 3UTR 100% 13.200 9.240 N NPR3 n/a
11 TRCN0000357660 GATGCCAACGGAGACCGATAT pLKO_005 512 CDS 100% 10.800 7.560 N NPR3 n/a
12 TRCN0000167967 CCATGTTTAATGGAGGGAAGA pLKO.1 4088 3UTR 100% 4.050 2.835 N NPR3 n/a
13 TRCN0000009201 CCTGAGATTCTTTAAGGAGAT pLKO.1 948 3UTR 100% 4.050 2.835 N NPR3 n/a
14 TRCN0000172454 CTTCTCCCTATTCACAGGCTT pLKO.1 4186 3UTR 100% 2.640 1.848 N NPR3 n/a
15 TRCN0000168284 GTTTAATGGAGGGAAGAGAGA pLKO.1 4092 3UTR 100% 2.640 1.848 N NPR3 n/a
16 TRCN0000168660 GAAGAGAGAAATGCATGGGAA pLKO.1 4104 3UTR 100% 2.640 1.584 N NPR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364458.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488510 AAGGGAAACGTAGGGATGCTCTCT pLX_317 23.3% 54.4% 53% V5 (many diffs) n/a
2 TRCN0000489823 CTTGACCTCCTCCCAGTACTTTTG pLX_317 16.2% 54.4% 53% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_14719 pDONR223 52.4% 54.2% .8% None (many diffs) n/a
4 ccsbBroad304_14719 pLX_304 0% 54.2% .8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000476668 CGTGTTGAAGCGCTGCGCAGTTTG pLX_317 27.1% 54.2% .8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV