Construct: ORF TRCN0000489859
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021632.1_s317c1
- DNA Barcode:
- GAATTCCCAACAAACTGACATGCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NR2C2 (7182)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489859
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | NM_003298.5 | 100% | 100% | |
| 2 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_011534064.3 | 100% | 100% | |
| 3 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_011534065.3 | 100% | 100% | |
| 4 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_011534066.3 | 100% | 100% | |
| 5 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | NM_001291694.2 | 96.9% | 96.9% | 70_71ins57 |
| 6 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_017007120.1 | 96.9% | 96.9% | 70_71ins57 |
| 7 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_011534058.3 | 94.9% | 94.9% | 1_99del |
| 8 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_011534059.2 | 94.9% | 94.9% | 1_99del |
| 9 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_011534061.3 | 94.9% | 94.9% | 1_99del |
| 10 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_017007118.2 | 94.9% | 94.9% | 1_99del |
| 11 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_017007119.1 | 94.9% | 94.9% | 1_99del |
| 12 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_011534063.3 | 91.9% | 91.9% | 1_99del;169_170ins57 |
| 13 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_024453739.1 | 67.8% | 67.8% | 0_1ins594 |
| 14 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | NM_011630.3 | 89.7% | 95.2% | (many diffs) |
| 15 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | XM_006505904.3 | 89.7% | 95.2% | (many diffs) |
| 16 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | XM_006505905.3 | 89.7% | 95.2% | (many diffs) |
| 17 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | XM_006505906.3 | 89.7% | 95.2% | (many diffs) |
| 18 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | NM_001347342.1 | 85.1% | 90.4% | (many diffs) |
| 19 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | XM_006505902.2 | 85.1% | 90.4% | (many diffs) |
| 20 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | XM_017321517.1 | 62.8% | 66.6% | (many diffs) |
| 21 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | XM_017321518.1 | 62.8% | 66.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1917
- ORF length:
- 1845
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaccagc ccctccccac gcatccagat aatctccacc gactctgctg 121 tagcctcacc tcagcgcatt cagggctctg aacctgcctc tggcccattg agtgttttca 181 catctttgaa caaagagaag attgtcacag accagcagac aggacagaaa atccagatag 241 tcaccgcagt ggacgcctcc ggatccccca aacagcagtt catcctgacc agcccagatg 301 gagctggaac tgggaaggtg atcctggctt ccccagagac atccagcgcc aagcaactca 361 tattcaccac ctcagacaac ctcgtccctg gcaggatcca gattgtcacg gattctgcct 421 ctgtggagcg tttactgggg aagacggacg tccagcggcc ccaggtggta gagtactgtg 481 tggtctgtgg cgacaaagcc tccggccgtc actatggggc tgtcagttgt gaaggttgca 541 aaggtttctt caaaaggagt gtgaggaaaa atttgaccta cagctgccgg agcaaccaag 601 actgcatcat caataaacat caccggaacc gctgtcagtt ttgccggctg aaaaaatgct 661 tagagatggg catgaaaatg gaatctgtgc agagtgaacg gaagcccttc gatgtgcaac 721 gggagaaacc aagcaattgt gctgcttcaa ctgagaaaat ctatatccgg aaagacctga 781 gaagtcccct gatagctact cccacgtttg tggcagacaa agatggagca agacaaacag 841 gtcttcttga tccagggatg cttgtgaaca tccagcagcc tttgatacgt gaggatggta 901 cagttctcct ggccacggat tctaaggctg aaacaagcca gggagctctg ggcacactgg 961 caaatgtagt gacctccctt gccaacctaa gtgaatcttt gaacaacggt gacacttcag 1021 aaatccagcc agaggaccag tctgcaagtg agataactcg ggcatttgat accttagcta 1081 aagcacttaa taccacagac agctcctctt ctccaagctt ggcagatggg atagacacca 1141 gtggaggagg gagcatccac gtcatcagca gagaccagtc gacacccatc attgaggttg 1201 aaggccccct cctttcagac acacacgtca catttaagct aacaatgccc agtccaatgc 1261 cagagtacct caacgtgcac tacatctgtg agtctgcatc ccgtctgctt ttcctctcaa 1321 tgcactgggc tcggtcaatc ccagcctttc aggcacttgg gcaggactgc aacaccagcc 1381 ttgtgcgggc ctgctggaat gagctcttca ccctcggcct ggcccagtgt gcccaggtca 1441 tgagtctctc caccatcctg gctgccattg tcaaccacct GCAGAACAGC ATCCAGGAAG 1501 ATAAACTTTC TGGTGACCGG ATAAAGCAAG TCATGGAGCA CATCTGGAAG CTGCAGGAGT 1561 TCTGTAACAG CATGGCGAAG CTGGATATAG ATGGCTATGA GTATGCATAC CTTAAAGCTA 1621 TAGTTCTCTT TAGCCCCGAT CATCCAGGTT TGACCAGCAC AAGCCAGATT GAAAAATTCC 1681 AAGAAAAGGC ACAGATGGAG TTGCAGGACT ATGTTCAGAA AACCTACTCA GAAGACACCT 1741 ACCGATTGGC CCGGATCCTC GTTCGCCTGC CGGCACTCAG GCTGATGAGC TCCAACATAA 1801 CAGAAGAACT TTTTTTTACT GGTCTCATTG GCAATGTTTC GATAGACAGC ATAATCCCCT 1861 ACATCCTCAA GATGGAGACA GCAGAGTATA ATGGCCAGAT CACCGGAGCC AGTCTATGAG 1921 ACCCAGCTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1981 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 2041 TTTATATATC TTGTGGAAAG GACGAGAATT CCCAACAAAC TGACATGCAA CGCGTTAAGT 2101 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt