Transcript: Human XM_024453739.1

PREDICTED: Homo sapiens nuclear receptor subfamily 2 group C member 2 (NR2C2), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NR2C2 (7182)
Length:
8108
CDS:
594..1847

Additional Resources:

NCBI RefSeq record:
XM_024453739.1
NBCI Gene record:
NR2C2 (7182)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453739.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245174 AGGGTGACATTTCCGTATATT pLKO_005 6183 3UTR 100% 15.000 21.000 N NR2C2 n/a
2 TRCN0000245171 GCATGGCGAAGCTGGATATAG pLKO_005 1498 CDS 100% 13.200 18.480 N NR2C2 n/a
3 TRCN0000021654 CGTCACATTTAAGCTAACAAT pLKO.1 1154 CDS 100% 5.625 7.875 N NR2C2 n/a
4 TRCN0000021657 GCTATGAGTATGCATACCTTA pLKO.1 1522 CDS 100% 4.950 6.930 N NR2C2 n/a
5 TRCN0000245173 GGCTGATGAGCTCCAACATAA pLKO_005 1708 CDS 100% 13.200 9.240 N NR2C2 n/a
6 TRCN0000245172 TATGAGTATGCATACCTTAAA pLKO_005 1524 CDS 100% 13.200 9.240 N NR2C2 n/a
7 TRCN0000222367 CCAACATAACAGAAGAACTTT pLKO.1 1720 CDS 100% 5.625 3.938 N Nr2c2 n/a
8 TRCN0000021658 CCAGCACAAGCCAGATTGAAA pLKO.1 1582 CDS 100% 5.625 3.938 N NR2C2 n/a
9 TRCN0000021655 CCACGGATTCTAAGGCTGAAA pLKO.1 841 CDS 100% 4.950 3.465 N NR2C2 n/a
10 TRCN0000021656 CCTAAGTGAATCTTTGAACAA pLKO.1 914 CDS 100% 4.950 3.465 N NR2C2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453739.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489859 GAATTCCCAACAAACTGACATGCA pLX_317 24% 67.8% 67.8% V5 (not translated due to prior stop codon) 0_1ins594 n/a
2 TRCN0000491841 CCGTAGACTGTAACGTTAATAGGG pLX_317 20.9% 67.6% 67.8% V5 0_1ins594;1250_1251delTA n/a
3 TRCN0000489922 GTAGTTGACTTTACAATATGTATT pLX_317 22.8% 64.3% 64.3% V5 (not translated due to prior stop codon) 0_1ins693;96C>T n/a
4 TRCN0000489583 GCTATTGACAGTTTAGAGAGAGTT pLX_317 19.4% 64.2% 64.3% V5 0_1ins693;1250_1251delTA n/a
5 ccsbBroadEn_11201 pDONR223 100% 53.5% 52.1% None (many diffs) n/a
6 ccsbBroad304_11201 pLX_304 0% 53.5% 52.1% V5 (many diffs) n/a
7 TRCN0000466070 CGATGCCGCGCTCGGGAAGCGGAT pLX_317 20.7% 53.5% 52.1% V5 (many diffs) n/a
Download CSV