Construct: ORF TRCN0000489922
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021631.1_s317c1
- DNA Barcode:
- GTAGTTGACTTTACAATATGTATT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NR2C2 (7182)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489922
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_011534058.3 | 99.9% | 100% | 789C>T |
| 2 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_011534059.2 | 99.9% | 100% | 789C>T |
| 3 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_011534061.3 | 99.9% | 100% | 789C>T |
| 4 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_017007118.2 | 99.9% | 100% | 789C>T |
| 5 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_017007119.1 | 99.9% | 100% | 789C>T |
| 6 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_011534063.3 | 97% | 97% | 169_170ins57;732C>T |
| 7 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | NM_003298.5 | 94.8% | 94.9% | 0_1ins99;690C>T |
| 8 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_011534064.3 | 94.8% | 94.9% | 0_1ins99;690C>T |
| 9 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_011534065.3 | 94.8% | 94.9% | 0_1ins99;690C>T |
| 10 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_011534066.3 | 94.8% | 94.9% | 0_1ins99;690C>T |
| 11 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | NM_001291694.2 | 91.9% | 91.9% | 0_1ins99;70_71ins57;633C>T |
| 12 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_017007120.1 | 91.9% | 91.9% | 0_1ins99;70_71ins57;633C>T |
| 13 | human | 7182 | NR2C2 | nuclear receptor subfamily ... | XM_024453739.1 | 64.3% | 64.3% | 0_1ins693;96C>T |
| 14 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | NM_001347342.1 | 90% | 95.2% | (many diffs) |
| 15 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | XM_006505902.2 | 90% | 95.2% | (many diffs) |
| 16 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | NM_011630.3 | 85% | 90.4% | (many diffs) |
| 17 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | XM_006505904.3 | 85% | 90.4% | (many diffs) |
| 18 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | XM_006505905.3 | 85% | 90.4% | (many diffs) |
| 19 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | XM_006505906.3 | 85% | 90.4% | (many diffs) |
| 20 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | XM_017321517.1 | 59.5% | 63.2% | (many diffs) |
| 21 | mouse | 22026 | Nr2c2 | nuclear receptor subfamily ... | XM_017321518.1 | 59.5% | 63.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2016
- ORF length:
- 1944
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggctaca aatatggagg ggctggttca gcacagagtg gggacccagc 121 aggtggctga ggtaacacgt acacagacct ctcggccgga atctccaggg atgaccagcc 181 cctccccacg catccagata atctccaccg actctgctgt agcctcacct cagcgcattc 241 agggctctga acctgcctct ggcccattga gtgttttcac atctttgaac aaagagaaga 301 ttgtcacaga ccagcagaca ggacagaaaa tccagatagt caccgcagtg gacgcctccg 361 gatcccccaa acagcagttc atcctgacca gcccagatgg agctggaact gggaaggtga 421 tcctggcttc cccagagaca tccagcgcca agcaactcat attcaccacc tcagacaacc 481 tcgtccctgg caggatccag attgtcacgg attctgcctc tgtggagcgt ttactgggga 541 agacggacgt ccagcggccc caggtggtag agtactgtgt ggtctgtggc gacaaagcct 601 ccggccgtca ctatggggct gtcagttgtg aaggttgcaa aggtttcttc aaaaggagtg 661 tgaggaaaaa tttgacctac agctgccgga gcaaccaaga ctgcatcatc aataaacatc 721 accggaaccg ctgtcagttt tgccggctga aaaaatgctt agagatgggc atgaaaatgg 781 aatctgtgca gagtgaacgg aagcccttcg atgtgcaacg ggagaaacca agcaattgtg 841 ctgcttcaac tgagaaaatt tatatccgga aagacctgag aagtcccctg atagctactc 901 ccacgtttgt ggcagacaaa gatggagcaa gacaaacagg tcttcttgat ccagggatgc 961 ttgtgaacat ccagcagcct ttgatacgtg aggatggtac agttctcctg gccacggatt 1021 ctaaggctga aacaagccag ggagctctgg gcacactggc aaatgtagtg acctcccttg 1081 ccaacctaag tgaatctttg aacaacggtg acacttcaga aatccagcca gaggaccagt 1141 ctgcaagtga gataactcgg gcatttgata ccttagctaa agcacttaat accacagaca 1201 gctcctcttc tccaagcttg gcagatggga tagacaccag tggaggaggg agcatccacg 1261 tcatcagcag agaccagtcg acacccatca ttgaggttga aggccccctc ctttcagaca 1321 cacacgtcac atttaagcta acaatgccca gtccaatgcc agagtacctc aacgtgcact 1381 acatctgtga gtctgcatcc cgtctgcttt tcctctcaat gcactgggct cggtcaatcc 1441 cagcctttca ggcacttggg caggactgca acaccagcct tgtgcgggcc tgctggaatg 1501 agctcttcac cctcggcctg gcccagtgtg cccaggtcat gagtctctcc accatcctgg 1561 ctgccattgt caaccacctG CAGAACAGCA TCCAGGAAGA TAAACTTTCT GGTGACCGGA 1621 TAAAGCAAGT CATGGAGCAC ATCTGGAAGC TGCAGGAGTT CTGTAACAGC ATGGCGAAGC 1681 TGGATATAGA TGGCTATGAG TATGCATACC TTAAAGCTAT AGTTCTCTTT AGCCCCGATC 1741 ATCCAGGTTT GACCAGCACA AGCCAGATTG AAAAATTCCA AGAAAAGGCA CAGATGGAGT 1801 TGCAGGACTA TGTTCAGAAA ACCTACTCAG AAGACACCTA CCGATTGGCC CGGATCCTCG 1861 TTCGCCTGCC GGCACTCAGG CTGATGAGCT CCAACATAAC AGAAGAACTT TTTTTTACTG 1921 GTCTCATTGG CAATGTTTCG ATAGACAGCA TAATCCCCTA CATCCTCAAG ATGGAGACAG 1981 CAGAGTATAA TGGCCAGATC ACCGGAGCCA GTCTATGAGA CCCAGCTTTC TTGTACAAAG 2041 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 2101 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 2161 ACGAGTAGTT GACTTTACAA TATGTATTAC GCGTTAAGTC gacaatcaac ctctggatta 2221 caaaatttgt gaaagatt