Construct: ORF TRCN0000491324
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020536.2_s317c1
- DNA Barcode:
- GCTAAGGACGCAATCATAGTCAAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- DGUOK (1716)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491324
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 1716 | DGUOK | deoxyguanosine kinase | NM_080916.3 | 100% | 100% | |
2 | human | 1716 | DGUOK | deoxyguanosine kinase | XM_011532647.2 | 97.8% | 97.8% | 423_424insAGGTCTGTGTACAGTGAC |
3 | human | 1716 | DGUOK | deoxyguanosine kinase | NM_080918.3 | 68.2% | 68.2% | 443_444ins264 |
4 | human | 1716 | DGUOK | deoxyguanosine kinase | NM_001318859.2 | 66% | 66% | 425_426ins282 |
5 | human | 1716 | DGUOK | deoxyguanosine kinase | NM_001318860.2 | 64.9% | 64.9% | 0_1ins291 |
6 | human | 1716 | DGUOK | deoxyguanosine kinase | NM_001318861.2 | 64.9% | 64.9% | 0_1ins291 |
7 | human | 1716 | DGUOK | deoxyguanosine kinase | XM_024452739.1 | 64.9% | 64.9% | 0_1ins291 |
8 | human | 1716 | DGUOK | deoxyguanosine kinase | NM_001318862.2 | 62.8% | 62.8% | 0_1ins291;132_133insAGGTCTGTGTACAGTGAC |
9 | human | 1716 | DGUOK | deoxyguanosine kinase | NM_001318863.2 | 62.8% | 62.8% | 0_1ins291;132_133insAGGTCTGTGTACAGTGAC |
10 | human | 1716 | DGUOK | deoxyguanosine kinase | XR_244926.3 | 62.6% | 1_83del;674_675ins116;799_1026del | |
11 | human | 1716 | DGUOK | deoxyguanosine kinase | XR_001738656.1 | 59.7% | 1_84del;524_525ins148;768_995del | |
12 | human | 1716 | DGUOK | deoxyguanosine kinase | NR_134897.2 | 56.9% | (many diffs) | |
13 | human | 1716 | DGUOK | deoxyguanosine kinase | NR_134894.2 | 56% | (many diffs) | |
14 | human | 1716 | DGUOK | deoxyguanosine kinase | NR_134898.2 | 53% | (many diffs) | |
15 | human | 1716 | DGUOK | deoxyguanosine kinase | NR_134893.2 | 42.2% | (many diffs) | |
16 | human | 1716 | DGUOK | deoxyguanosine kinase | NR_134896.2 | 40.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 903
- ORF length:
- 831
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggccgcg ggccgcctct ttctaagtcg gcttcgagca cccttcagtt 121 ccatggccaa gagcccactc gagggcgttt cctcctccag aggcctgcac gcggggcgcg 181 ggccccgaag gctctccatc gaaggcaaca ttgctgtggg aaagtccacg tttgtgaagt 241 tactcacgaa aacttaccca gaatggcacg tagctacaga acctgtagca acatggcaga 301 atatccaggc tgctggcacc caaaaagcct gcactgccca aagtcttgga aacttgctgg 361 atatgatgta ccgggagcca gcacgatggt cctacacatt ccagacattt tcctttttga 421 gccgcctgaa agtacagctg gagcccttcc ctgagaaact cttacaggcc aggaagccag 481 tacagatctt tgagaggtct gtgtacagtg acaggtatat ctttgcaaag aatctttttg 541 aaaatggTTC CCTCAGTGAC ATCGAGTGGC ATATCTATCA GGACTGGCAT TCTTTTCTCC 601 TGTGGGAGTT TGCCAGCCGG ATCACATTAC ATGGCTTCAT CTACCTCCAG GCTTCTCCCC 661 AGGTTTGTTT GAAGAGACTG TACCAGAGGG CCAGGGAGGA GGAGAAAGGA ATTGAGCTGG 721 CCTATCTAGA GCAGCTGCAT GGCCAACACG AAGCCTGGCT TATTCACAAG ACAACGAAGC 781 TCCACTTTGA GGCTCTGATG AACATTCCAG TGCTGGTGTT GGATGTCAAT GATGATTTTT 841 CTGAGGAAGT AACCAAACAA GAAGACCTCA TGAGAGAGGT AAACACCTTT GTAAAGAATC 901 TGTAGAACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 961 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1021 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGCTAAGGAC GCAATCATAG TCAACACGCG 1081 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt