Transcript: Human NM_080918.3

Homo sapiens deoxyguanosine kinase (DGUOK), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
DGUOK (1716)
Length:
811
CDS:
32..601

Additional Resources:

NCBI RefSeq record:
NM_080918.3
NBCI Gene record:
DGUOK (1716)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147942 CTACAGAACCTGTAGCAACA pXPR_003 TGG 219 38% 2 0.6422 DGUOK DGUOK 76603
2 BRDN0001147023 AGGAGGAAACGCCCTCGAGT pXPR_003 GGG 68 12% 1 0.4394 DGUOK DGUOK 76602
3 BRDN0001148589 GCTATTTGCATTGCAGCTGT pXPR_003 GGG 143 25% 2 -0.1930 DGUOK DGUOK 76604
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010993 CACTGCCCAAAGTCTTGGAAA pLKO.1 292 CDS 100% 4.950 6.930 N DGUOK n/a
2 TRCN0000197112 GACCTCATGAGAGAGGTAAAC pLKO.1 560 CDS 100% 1.080 1.512 N DGUOK n/a
3 TRCN0000006077 AGCACGATGGTCCTACACATT pLKO.1 340 CDS 100% 4.950 3.960 N DGUOK n/a
4 TRCN0000338412 AGCACGATGGTCCTACACATT pLKO_005 340 CDS 100% 4.950 3.960 N DGUOK n/a
5 TRCN0000006075 TCCTACACATTCCAGACATTT pLKO.1 350 CDS 100% 13.200 9.240 N DGUOK n/a
6 TRCN0000006076 CTCTCCATCGAAGGCAACATT pLKO.1 152 CDS 100% 5.625 3.938 N DGUOK n/a
7 TRCN0000338411 CTCTCCATCGAAGGCAACATT pLKO_005 152 CDS 100% 5.625 3.938 N DGUOK n/a
8 TRCN0000006074 CCTGACTTTCTGAAGCTAGAA pLKO.1 637 3UTR 100% 4.950 3.465 N DGUOK n/a
9 TRCN0000338413 CCTGACTTTCTGAAGCTAGAA pLKO_005 637 3UTR 100% 4.950 3.465 N DGUOK n/a
10 TRCN0000195678 CCACGTTTGTGAAGTTACTCA pLKO.1 186 CDS 100% 3.000 2.100 N DGUOK n/a
11 TRCN0000338472 CCACGTTTGTGAAGTTACTCA pLKO_005 186 CDS 100% 3.000 2.100 N DGUOK n/a
12 TRCN0000195404 CCAATACCATGAAGTTCAGGC pLKO.1 602 CDS 100% 2.160 1.512 N DGUOK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00441 pDONR223 100% 68.2% 68.2% None 443_444ins264 n/a
2 ccsbBroad304_00441 pLX_304 0% 68.2% 68.2% V5 443_444ins264 n/a
3 TRCN0000480725 AAAACGCGAACATGTACCTCGCAC pLX_317 53.1% 68.2% 68.2% V5 443_444ins264 n/a
4 ccsbBroadEn_14614 pDONR223 0% 68.2% 68.2% None 443_444ins264 n/a
5 ccsbBroad304_14614 pLX_304 0% 68.2% 68.2% V5 443_444ins264 n/a
6 TRCN0000471786 AACATGAGCGCGCTTACCGAGTAA pLX_317 52.3% 68.2% 68.2% V5 (not translated due to prior stop codon) 443_444ins264 n/a
7 TRCN0000491324 GCTAAGGACGCAATCATAGTCAAC pLX_317 42.9% 68.2% 68.2% V5 (not translated due to prior stop codon) 443_444ins264 n/a
8 TRCN0000489258 GTCTGGCTTAAGCCTTTACTATTC pLX_317 42.1% 68.1% 67.9% V5 443_444ins264;567_568insG n/a
9 ccsbBroadEn_10777 pDONR223 100% 48.6% 48.6% None 1_291del n/a
10 ccsbBroad304_10777 pLX_304 0% 48.6% 48.6% V5 1_291del n/a
11 TRCN0000471348 CAATAATAGTGCTCTGAGAGCACT pLX_317 100% 48.6% 48.6% V5 1_291del n/a
12 TRCN0000487744 TTCGACTTTACGATACGGTGATCC pLX_317 67.5% 47% 26% V5 (not translated due to prior stop codon) 143_255del;381_567del n/a
Download CSV