Construct: ORF TRCN0000491634
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019825.2_s317c1
- DNA Barcode:
- TGACAAGGGTGTTAACCTTACAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PKMYT1 (9088)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491634
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9088 | PKMYT1 | protein kinase, membrane as... | NM_004203.5 | 99.9% | 99.8% | 1497_1498insG |
| 2 | human | 9088 | PKMYT1 | protein kinase, membrane as... | XM_011522734.3 | 99.9% | 99.8% | 1497_1498insG |
| 3 | human | 9088 | PKMYT1 | protein kinase, membrane as... | XM_024450490.1 | 99.9% | 99.8% | 1497_1498insG |
| 4 | human | 9088 | PKMYT1 | protein kinase, membrane as... | NM_001258451.2 | 98.1% | 98% | 0_1ins27;1470_1471insG |
| 5 | human | 9088 | PKMYT1 | protein kinase, membrane as... | XM_011522735.3 | 98.1% | 98% | 0_1ins27;1470_1471insG |
| 6 | human | 9088 | PKMYT1 | protein kinase, membrane as... | XM_011522736.3 | 98.1% | 98% | 0_1ins27;1470_1471insG |
| 7 | human | 9088 | PKMYT1 | protein kinase, membrane as... | NM_182687.3 | 91.2% | 89.4% | 1310_1347del;1440_1441ins96 |
| 8 | human | 9088 | PKMYT1 | protein kinase, membrane as... | NM_001258450.2 | 85.8% | 85.2% | (many diffs) |
| 9 | mouse | 268930 | Pkmyt1 | protein kinase, membrane as... | NM_023058.3 | 83.8% | 87.6% | (many diffs) |
| 10 | mouse | 268930 | Pkmyt1 | protein kinase, membrane as... | XM_006524310.2 | 78.4% | 81.8% | (many diffs) |
| 11 | mouse | 268930 | Pkmyt1 | protein kinase, membrane as... | XM_006524311.3 | 77.9% | 81.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1569
- ORF length:
- 1500
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gctagaacgg cctcctgcac tggccatgcc catgcccacg gagggcaccc 121 cgccacctct gagtggcacc cccatcccag tcccagccta cttccgccac gcagaacctg 181 gattctccct caagaggccc agggggctca gccggagcct cccacctccg ccccctgcca 241 agggcagcat tcccatcagc cgcctcttcc ctcctcggac cccaggctgg caccagctgc 301 agccccggcg ggtgtcattc cggggcgagg cctcagagac tctgcagagc cctgggtatg 361 acccaagccg gccagagtcc ttcttccagc agagcttcca gaggctcagc cgcctgggcc 421 atggctccta cggagaggtc ttcaaggtgc gctccaagga ggacggccgg ctctatgcgg 481 taaagcgttc catgtcacca ttccggggcc ccaaggaccg ggcccgcaag ttggccgagg 541 tgggcagcca cgagaaggtg gggcagcacc catgctgcgt gcggctggag caggcctggg 601 aggagggcgg catcctgtac ctgcagacgg agctgtgcgg gcccagcctg cagcaacact 661 gtgaggcctg gggtgccagc ctgcctgagg cccaggtctg gggctacctg cgggacacgc 721 tgcttgccct ggcccatctg cacagccagg gcctggtgca ccttgatgtc aagcctgcca 781 acatcttcct ggggccccgg ggccgctgca agctgggtga cttcggactg ctggtggagc 841 tgggtacagc aggagctggt gaggtccagg agggagaccc ccgctacatg gcccccgagc 901 tgctgcaggg ctcctatggg acagcagcgg atgtgttcag tctgggcctc accatcctgg 961 aagtggcatg caacatggag ctgccccacg gtggggaggg ctggcagcag ctgcgccagg 1021 gctacctgcc ccctgagttc actgccggtc tgtcttccga gctgcgttct gtccttgtca 1081 tgatgctgga gccagacccc aagctgcggg ccacggccga ggccctgctg gcactgcctg 1141 tgttgaggca gccgcgggcc tggggtgtgc tgtggtgcat ggcagcggag gccctgagcc 1201 gagggtgggc cctgtggcag gccctgcttg ccctgctctg ctggcTCTGG CATGGGCTGG 1261 CTCACCCTGC CAGCTGGCTA CAGCCCCTGG GCCCGCCAGC CACCCCGCCT GGCTCACCAC 1321 CCTGCAGTTT GCTCCTGGAC AGCAGCCTCT CCAGCAACTG GGATGACGAC AGCCTAGGGC 1381 CTTCACTCTC CCCTGAGGCT GTCCTGGCCC GGACTGTGGG GAGCACCTCC ACCCCCCGGA 1441 GCAGGTGCAC ACCCAGGGAT GCCCTGGACC TAAGTGACAT CAACTCAGAG CCTCCTCGGG 1501 GCTCCTTCCC CTCCTTTGAG CCTCGGAACC TCCTCAGCCT GTTTGAGGAC ACCCTAGACC 1561 CAACCGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1621 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1681 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATGACAAGGG TGTTAACCTT ACAATACGCG 1741 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt