Construct: ORF TRCN0000491914
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020345.2_s317c1
- DNA Barcode:
- CGTACTATCAGCCACAACAGATGG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CAMK2A (815)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491914
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 815 | CAMK2A | calcium/calmodulin dependen... | NM_001363990.1 | 99.7% | 99.7% | (many diffs) |
| 2 | human | 815 | CAMK2A | calcium/calmodulin dependen... | NM_171825.2 | 99.7% | 99.7% | (many diffs) |
| 3 | human | 815 | CAMK2A | calcium/calmodulin dependen... | NM_001369025.2 | 99.7% | 99.5% | (many diffs) |
| 4 | human | 815 | CAMK2A | calcium/calmodulin dependen... | NM_001363989.1 | 97.4% | 97.5% | (many diffs) |
| 5 | human | 815 | CAMK2A | calcium/calmodulin dependen... | NM_015981.4 | 97.4% | 97.5% | (many diffs) |
| 6 | human | 816 | CAMK2B | calcium/calmodulin dependen... | NM_172083.3 | 79.9% | 85% | (many diffs) |
| 7 | human | 816 | CAMK2B | calcium/calmodulin dependen... | NM_172084.3 | 75.3% | 80.4% | (many diffs) |
| 8 | mouse | 12322 | Camk2a | calcium/calmodulin-dependen... | NM_177407.4 | 93.1% | 99.5% | (many diffs) |
| 9 | mouse | 12322 | Camk2a | calcium/calmodulin-dependen... | XM_017317805.2 | 93% | 99.3% | (many diffs) |
| 10 | mouse | 12322 | Camk2a | calcium/calmodulin-dependen... | XM_006525541.4 | 91% | 97.3% | (many diffs) |
| 11 | mouse | 12323 | Camk2b | calcium/calmodulin-dependen... | XM_006514479.2 | 76.2% | 81.1% | (many diffs) |
| 12 | mouse | 12323 | Camk2b | calcium/calmodulin-dependen... | XM_006514476.1 | 74.1% | 78.8% | (many diffs) |
| 13 | mouse | 12323 | Camk2b | calcium/calmodulin-dependen... | XM_006514477.1 | 74% | 78.8% | (many diffs) |
| 14 | mouse | 12323 | Camk2b | calcium/calmodulin-dependen... | XM_006514475.1 | 73% | 77.6% | (many diffs) |
| 15 | mouse | 12323 | Camk2b | calcium/calmodulin-dependen... | XM_017314240.1 | 72.9% | 77.5% | (many diffs) |
| 16 | mouse | 12323 | Camk2b | calcium/calmodulin-dependen... | NM_007595.5 | 71% | 75.5% | (many diffs) |
| 17 | mouse | 12323 | Camk2b | calcium/calmodulin-dependen... | XM_017314239.1 | 70.9% | 75.3% | (many diffs) |
| 18 | mouse | 12322 | Camk2a | calcium/calmodulin-dependen... | NM_001286809.1 | 35.3% | 34.7% | (many diffs) |
| 19 | mouse | 12322 | Camk2a | calcium/calmodulin-dependen... | NM_009792.3 | 34.5% | 33.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1506
- ORF length:
- 1434
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggctacc atcacctgca cccgcttcac ggaagagtac cagctcttcg 121 aggaattggg caagggagcc ttctcggtgg tgcgaaggtg tgtgaaggtg ctggctggcc 181 aggagtatgc tgccaagatc atcaacacaa agaagctgtc agccagagac catcagaagc 241 tggagcgtga agcccgcatc tgccgcctgc tgaagcaccc caacatcgtc cgactacatg 301 acagcatctc agaggaggga caccactacc tgatcttcga cctggtcact ggtggggaac 361 tgtttgaaga tatcgtggcc cgggagtatt acagtgaggc ggatgccagt cactgtatcc 421 agcagatcct ggaggctgtg ctgcactgcc accagatggg ggtggtgcac cgggacctga 481 agcctgagaa tctgttgctg gcctccaagc tcaagggtgc cgcagtgaag ctggcagact 541 ttggcctggc catagaggtg gagggggagc agcaggcatg gtttgggttt gcagggactc 601 ctggatatct ctccccagaa gtgctgcgga aggacccgta cgggaagcct gtggacctgt 661 gggcttgtgg ggtcatcctg tacatcctgc tggttgggta ccccccgttc tgggatgagg 721 accagcaccg cctgtacctg cagatcaaag ccggcgccta tgatttccca tcgccggaat 781 gggacactgt caccccggaa gccaaggatc tgatcaataa gatgctgacc attaacccat 841 ccaaacgcat cacagctgcc gaagccctta agcacccctg gatctcgcac cgctccaccg 901 tggcatcctg catgcacaga caggagaccg tggactgcct gaagaagttc aatgccagga 961 ggaaactgaa gggagccatt ctcaccacga tgctggccac caggaacttc tccggaggga 1021 agagtggggg aaacaagaag agcgatggtg tgaaggaatc cTCAGAGAGC ACCAACACCA 1081 CCATCGAGGA TGAAGACACC AAAGTGCGGA AACAGGAAAT TATAAAAGTG ACAGAGCAGC 1141 TGATTGAAGC CATAAGCAAT GGAGATTTTG AGTCCTACAC GAAGATGTGC GACCCTGGCA 1201 TGACAGCCTT CGAACCTGAG GCCCTGGGGA ACCTGGTTGA GGGCCTGGAC TTCCATCGAT 1261 TCTATTTTGA AAACCTGTGG TCCCGGAACA GCAAGCCCGT GCACACCACC ATCCTGAATC 1321 CCCACATCCA CCTGATGGGC GACGAGTCAG CCTGCATCGC CTACATCCGC ATCACGCAGT 1381 ACCTGGACGC TGGCGGCATC CCACGCACCG CCCAGTCGGA GGAGACCCGT GTCTGGCACC 1441 GCCGGGACGG CAAATGGCAG ATCGTCCACT TCCACAGATC TGGGGCGCCC TCCGTCCTGC 1501 CCCATTGAGA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1561 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1621 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACGTACT ATCAGCCACA ACAGATGGAC 1681 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt