Transcript: Human NM_172084.3

Homo sapiens calcium/calmodulin dependent protein kinase II beta (CAMK2B), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CAMK2B (816)
Length:
3894
CDS:
174..1523

Additional Resources:

NCBI RefSeq record:
NM_172084.3
NBCI Gene record:
CAMK2B (816)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172084.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219642 TACCAGCTCTACGAGGATATT pLKO.1 213 CDS 100% 0.000 0.000 N CAMK2B n/a
2 TRCN0000000466 GACCAGATGTGATTTGTTAAA pLKO.1 1656 3UTR 100% 13.200 10.560 N CAMK2B n/a
3 TRCN0000195670 CCGGAAGCAGGAGATCATTAA pLKO.1 1121 CDS 100% 13.200 9.240 N CAMK2B n/a
4 TRCN0000000467 GATCATTAAGACCACGGAGCA pLKO.1 1133 CDS 100% 2.160 1.512 N CAMK2B n/a
5 TRCN0000199243 CCTGAGGTCCTTCGCAAAGAG pLKO.1 720 CDS 100% 1.650 1.155 N CAMK2B n/a
6 TRCN0000199539 CGCATGTTTGTGTCTGCCTCG pLKO.1 1599 3UTR 100% 0.400 0.280 N CAMK2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172084.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14563 pDONR223 93.6% 89.2% 89.2% None 944_945ins162 n/a
2 ccsbBroad304_14563 pLX_304 0% 89.2% 89.2% V5 944_945ins162 n/a
3 TRCN0000468031 AGCATTTCATGGTGGACCTTTAGT pLX_317 28.9% 85.2% 85.2% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_14564 pDONR223 0% 89.2% 89.2% None 944_945ins162 n/a
5 ccsbBroad304_14564 pLX_304 0% 89.2% 89.2% V5 944_945ins162 n/a
6 TRCN0000480225 GACAGTGGGGGTGATCTCGGAGCG pLX_317 22.3% 89.2% 89.2% V5 944_945ins162 n/a
7 TRCN0000488486 GACCTCCTCAAGAGGCAACGCTGC pLX_317 10.9% 82.8% 82.8% V5 (not translated due to prior stop codon) 944_945ins279 n/a
8 TRCN0000489411 AAGTGGCATAGCCCCCTCAAGCTG pLX_317 20.6% 82.7% 82.6% V5 944_945ins279;1347_1348insG n/a
9 TRCN0000489162 ACTTTTCATACCCTAGATACCCAC pLX_317 21.2% 75.5% 80.6% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000489374 GACATACGTTCGACTGTGGTTCTC pLX_317 23.3% 75.4% 80.6% V5 (many diffs) n/a
11 TRCN0000491914 CGTACTATCAGCCACAACAGATGG pLX_317 31.3% 75.3% 80.4% V5 (not translated due to prior stop codon) (many diffs) n/a
12 ccsbBroadEn_14562 pDONR223 100% 75.3% 46.3% None (many diffs) n/a
13 ccsbBroad304_14562 pLX_304 0% 75.3% 46.3% V5 (not translated due to prior stop codon) (many diffs) n/a
14 TRCN0000474396 TAATTGTTATTCACCCAAGAGACT pLX_317 23.8% 75.3% 46.3% V5 (not translated due to prior stop codon) (many diffs) n/a
15 ccsbBroadEn_14566 pDONR223 100% 69.6% 51.4% None (many diffs) n/a
16 ccsbBroad304_14566 pLX_304 0% 69.6% 51.4% V5 (not translated due to prior stop codon) (many diffs) n/a
17 TRCN0000480621 AAGACTGTGGCACCAACTCCCGCC pLX_317 29.4% 69.6% 51.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV