Transcript: Mouse XM_006525541.4

PREDICTED: Mus musculus calcium/calmodulin-dependent protein kinase II alpha (Camk2a), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Camk2a (12322)
Length:
5314
CDS:
473..1942

Additional Resources:

NCBI RefSeq record:
XM_006525541.4
NBCI Gene record:
Camk2a (12322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525541.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360322 AGTCAGCCTGCATCGCCTATA pLKO_005 1779 CDS 100% 10.800 15.120 N Camk2a n/a
2 TRCN0000012468 GCGTTCAGTTAATGGAATCTT pLKO.1 1476 CDS 100% 5.625 7.875 N Camk2a n/a
3 TRCN0000197215 GCCAAGGATCTGATCAATAAG pLKO.1 1202 CDS 100% 13.200 9.240 N CAMK2A n/a
4 TRCN0000360324 TGGACTTTCATCGATTCTATT pLKO_005 1680 CDS 100% 13.200 9.240 N Camk2a n/a
5 TRCN0000360321 TGTTGGCCTAGCCTAGCTTTA pLKO_005 2243 3UTR 100% 10.800 7.560 N Camk2a n/a
6 TRCN0000360395 TTCGCAGAGATCCGCTCTTTG pLKO_005 1973 3UTR 100% 10.800 7.560 N Camk2a n/a
7 TRCN0000012469 CCTGGACTTTCATCGATTCTA pLKO.1 1678 CDS 100% 5.625 3.938 N Camk2a n/a
8 TRCN0000012470 CGCAAACAGGAAATTATCAAA pLKO.1 1541 CDS 100% 5.625 3.938 N Camk2a n/a
9 TRCN0000012471 GCTGATCGAAGCCATAAGCAA pLKO.1 1573 CDS 100% 3.000 2.100 N Camk2a n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3315 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525541.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491914 CGTACTATCAGCCACAACAGATGG pLX_317 31.3% 91% 97.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489162 ACTTTTCATACCCTAGATACCCAC pLX_317 21.2% 91% 97.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000489374 GACATACGTTCGACTGTGGTTCTC pLX_317 23.3% 90.9% 97.3% V5 (many diffs) n/a
4 ccsbBroadEn_14562 pDONR223 100% 90.8% 46.8% None (many diffs) n/a
5 ccsbBroad304_14562 pLX_304 0% 90.8% 46.8% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000474396 TAATTGTTATTCACCCAAGAGACT pLX_317 23.8% 90.8% 46.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV