Transcript: Human NM_015981.4

Homo sapiens calcium/calmodulin dependent protein kinase II alpha (CAMK2A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
CAMK2A (815)
Length:
4837
CDS:
149..1618

Additional Resources:

NCBI RefSeq record:
NM_015981.4
NBCI Gene record:
CAMK2A (815)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149371 CCTCCAGCACCGCTCCACCG pXPR_003 TGG 826 56% 11 0.4904 CAMK2A CAMK2A 75753
2 BRDN0001162457 GACACTCACATCATAGGCGC pXPR_003 CGG 685 47% 9 0.4899 CAMK2A CAMK2A 76930
3 BRDN0001149531 GTGCTGCGGAAGGACCCGTA pXPR_003 CGG 566 39% 8 0.3195 CAMK2A CAMK2A 76928
4 BRDN0001162256 GGCCCGGGAGTATTACAGTG pXPR_003 AGG 322 22% 5 0.2536 CAMK2A CAMK2A 76929
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015981.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010284 GTGCGGAAACAGGAAATTATA pLKO.1 1214 CDS 100% 15.000 21.000 N CAMK2A n/a
2 TRCN0000010285 GGGACACCACTACCTGATCTT pLKO.1 394 CDS 100% 4.950 6.930 N CAMK2A n/a
3 TRCN0000194797 CATGACTTTATACGCAGTAAG pLKO.1 3113 3UTR 100% 10.800 7.560 N CAMK2A n/a
4 TRCN0000194796 CGTAAATGGATTTCGCGTTAA pLKO.1 2439 3UTR 100% 10.800 7.560 N CAMK2A n/a
5 TRCN0000010286 GACCATTAACCCATCCAAACG pLKO.1 904 CDS 100% 4.050 2.835 N CAMK2A n/a
6 TRCN0000197215 GCCAAGGATCTGATCAATAAG pLKO.1 878 CDS 100% 13.200 7.920 N CAMK2A n/a
7 TRCN0000194685 CAGGATTTCATCTCACCATAT pLKO.1 2841 3UTR 100% 10.800 6.480 N CAMK2A n/a
8 TRCN0000199562 CCCAACATCGTCCGACTACAT pLKO.1 356 CDS 100% 4.950 2.970 N CAMK2A n/a
9 TRCN0000012468 GCGTTCAGTTAATGGAATCTT pLKO.1 1152 CDS 100% 5.625 7.875 N Camk2a n/a
10 TRCN0000360322 AGTCAGCCTGCATCGCCTATA pLKO_005 1455 CDS 100% 10.800 7.560 N Camk2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015981.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489162 ACTTTTCATACCCTAGATACCCAC pLX_317 21.2% 97.6% 97.7% V5 (not translated due to prior stop codon) 984_1016del;1410T>C n/a
2 TRCN0000489374 GACATACGTTCGACTGTGGTTCTC pLX_317 23.3% 97.6% 97.5% V5 984_1016del;1410T>C;1467_1468insG n/a
3 ccsbBroadEn_14562 pDONR223 100% 97.4% 46.8% None (many diffs) n/a
4 ccsbBroad304_14562 pLX_304 0% 97.4% 46.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000474396 TAATTGTTATTCACCCAAGAGACT pLX_317 23.8% 97.4% 46.8% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000491914 CGTACTATCAGCCACAACAGATGG pLX_317 31.3% 97.4% 97.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV