Transcript: Mouse NM_009792.3

Mus musculus calcium/calmodulin-dependent protein kinase II alpha (Camk2a), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-17
Taxon:
Mus musculus (mouse)
Gene:
Camk2a (12322)
Length:
4268
CDS:
294..896

Additional Resources:

NCBI RefSeq record:
NM_009792.3
NBCI Gene record:
Camk2a (12322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009792.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360322 AGTCAGCCTGCATCGCCTATA pLKO_005 733 CDS 100% 10.800 15.120 N Camk2a n/a
2 TRCN0000012468 GCGTTCAGTTAATGGAATCTT pLKO.1 430 CDS 100% 5.625 7.875 N Camk2a n/a
3 TRCN0000012472 GTGTTGCTAACCCTCTACTTT pLKO.1 336 CDS 100% 5.625 7.875 N Camk2a n/a
4 TRCN0000360324 TGGACTTTCATCGATTCTATT pLKO_005 634 CDS 100% 13.200 9.240 N Camk2a n/a
5 TRCN0000360321 TGTTGGCCTAGCCTAGCTTTA pLKO_005 1197 3UTR 100% 10.800 7.560 N Camk2a n/a
6 TRCN0000360395 TTCGCAGAGATCCGCTCTTTG pLKO_005 927 3UTR 100% 10.800 7.560 N Camk2a n/a
7 TRCN0000012469 CCTGGACTTTCATCGATTCTA pLKO.1 632 CDS 100% 5.625 3.938 N Camk2a n/a
8 TRCN0000012470 CGCAAACAGGAAATTATCAAA pLKO.1 495 CDS 100% 5.625 3.938 N Camk2a n/a
9 TRCN0000012471 GCTGATCGAAGCCATAAGCAA pLKO.1 527 CDS 100% 3.000 2.100 N Camk2a n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2269 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009792.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14562 pDONR223 100% 35% 12.8% None (many diffs) n/a
2 ccsbBroad304_14562 pLX_304 0% 35% 12.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000474396 TAATTGTTATTCACCCAAGAGACT pLX_317 23.8% 35% 12.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000491914 CGTACTATCAGCCACAACAGATGG pLX_317 31.3% 34.5% 33.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489162 ACTTTTCATACCCTAGATACCCAC pLX_317 21.2% 34.5% 33.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489374 GACATACGTTCGACTGTGGTTCTC pLX_317 23.3% 34.5% 33.8% V5 (many diffs) n/a
Download CSV