Construct: ORF TRCN0000492027
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019262.2_s317c1
- DNA Barcode:
- TCCTTTATCAAACAGACGACCCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR137B (7107)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492027
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7107 | GPR137B | G protein-coupled receptor ... | NM_003272.4 | 99.9% | 99.7% | 1197_1198insG |
| 2 | human | 7107 | GPR137B | G protein-coupled receptor ... | XM_017002209.2 | 93.1% | 91.7% | (many diffs) |
| 3 | human | 7107 | GPR137B | G protein-coupled receptor ... | XM_017002210.2 | 89.1% | 89% | 837_838ins129;1068_1069insG |
| 4 | human | 7107 | GPR137B | G protein-coupled receptor ... | XR_247039.4 | 17.5% | 1_94del;1186_1333del;1440_6819delinsG | |
| 5 | mouse | 83924 | Gpr137b | G protein-coupled receptor ... | NM_031999.2 | 86.5% | 91% | (many diffs) |
| 6 | mouse | 83924 | Gpr137b | G protein-coupled receptor ... | XM_006516805.3 | 80.1% | 82% | (many diffs) |
| 7 | mouse | 664862 | Gpr137b-ps | G protein-coupled receptor ... | NR_003568.1 | 36% | (many diffs) | |
| 8 | mouse | 83924 | Gpr137b | G protein-coupled receptor ... | XR_382078.1 | 27.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1275
- ORF length:
- 1200
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgagg cccgagcgtc cccggccgcg cggcagcgcc cccggcccga 121 tggagacccc gccgtgggac ccagcccgca acgactcgct gccgcccacg ctgaccccgg 181 ccgtgccccc ctacgtgaag cttggcctca ccgtcgtcta caccgtgttc tacgcgctgc 241 tcttcgtgtt catctacgtg cagctctggc tggtgctgcg ttaccgccac aagcggctca 301 gctaccagag cgtcttcctc tttctctgcc tcttctgggc ctccctgcgg accgtcctct 361 tctccttcta cttcaaagac ttcgtggcgg ccaattcgct cagccccttc gtcttctggc 421 tgctctactg cttccctgtg tgcctgcagt ttttcaccct cacgctgatg aacttgtact 481 tcacgcaggt gattttcaaa gccaagtcaa aatattctcc agaattactc aaataccggt 541 tgcccctcta cctggcctcc ctcttcatca gccttgtttt cctgttggtg aatttaacct 601 gtgctgtgct ggtaaagacg ggaaattggg agaggaaggt tatcgtctct gtgcgagtgg 661 ccattaatga cacgctcttc gtgctgtgtg ccgtctctct ctccatctgt ctctacaaaa 721 tctctaagat gtccttagcc aacatttact tggagtccaa gggctcctcc gtgtgtcaag 781 tgactgccat cggtgtcacc gtgatactgc tttacacctc tcgggcctgc tacaacctgt 841 tcatcctgtc attttctcag aacaagagcg tccattcctt tgattatgac tggtacaatg 901 tatcagacca ggcagatttg aagaatcagc tgggagatgc tGGATACGTA TTATTTGGAG 961 TGGTGTTATT TGTTTGGGAA CTCTTACCTA CCACCTTAGT CGTTTATTTC TTCCGAGTTA 1021 GAAATCCTAC AAAGGACCTT ACCAACCCTG GAATGGTCCC CAGCCATGGA TTCAGTCCCA 1081 GATCTTATTT CTTTGACAAC CCTCGAAGAT ATGACAGTGA TGATGACCTT GCCTGGAACA 1141 TTGCCCCTCA GGGACTTCAG GGAGGTTTTG CTCCAGATTA CTATGATTGG GGACAACAAA 1201 CTAACAGCTT CCTGGCACAA GCAGGAACTT TGCAAGACTC AACTTTGGAT CCTGACAAAC 1261 CAAGCCTTGG GGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1321 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1381 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATCC TTTATCAAAC AGACGACCCC 1441 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t