Construct: ORF TRCN0000492111
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001212.1_s317c1
- Derived from:
- ccsbBroadEn_08857
- DNA Barcode:
- AACCCGCAACATGCCCGGTGGTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CPEB1 (64506)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492111
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001079534.2 | 99.9% | 100% | 1290A>G |
| 2 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001079535.2 | 99.9% | 100% | 1290A>G |
| 3 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001288819.1 | 99.9% | 100% | 1290A>G |
| 4 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365244.1 | 99.9% | 100% | 1290A>G |
| 5 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365245.1 | 99.9% | 100% | 1290A>G |
| 6 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365246.1 | 99.9% | 100% | 1290A>G |
| 7 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365247.1 | 99.9% | 100% | 1290A>G |
| 8 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365248.1 | 99.9% | 100% | 1290A>G |
| 9 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365249.1 | 99.9% | 100% | 1290A>G |
| 10 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001079533.2 | 98.9% | 98.9% | 835_849del;1305A>G |
| 11 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365250.1 | 98.9% | 98.9% | 835_849del;1305A>G |
| 12 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_030594.5 | 86.5% | 86.6% | 1_225del;1515A>G |
| 13 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365243.1 | 85.8% | 85.8% | 1_225del;1060_1074del;1530A>G |
| 14 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365240.1 | 82.5% | 82.6% | 1_306del;1596A>G |
| 15 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365241.1 | 82.5% | 82.6% | 1_306del;1596A>G |
| 16 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365242.1 | 82.5% | 82.6% | 1_306del;1596A>G |
| 17 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001288820.2 | 68.8% | 68.9% | 0_1ins453;837A>G |
| 18 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_011250790.2 | 90.4% | 94.7% | (many diffs) |
| 19 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_017321964.1 | 90.4% | 94.7% | (many diffs) |
| 20 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_017321965.1 | 87.2% | 89.1% | (many diffs) |
| 21 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_011250792.1 | 80% | 84.3% | (many diffs) |
| 22 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | NM_001252526.1 | 79.1% | 82.8% | (many diffs) |
| 23 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | NM_007755.5 | 78.4% | 82.1% | (many diffs) |
| 24 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | NM_001252525.1 | 78.3% | 82% | (many diffs) |
| 25 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_011250787.2 | 74.1% | 77.6% | (many diffs) |
| 26 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_011250786.2 | 74% | 77.5% | (many diffs) |
| 27 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_011250785.2 | 73.5% | 76.9% | (many diffs) |
| 28 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_011250784.2 | 73.3% | 76.8% | (many diffs) |
| 29 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_011250788.2 | 72% | 75.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1524
- ORF length:
- 1458
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct tttcccaacc tctgcgcaag aatcttcccg tggcctccca gatgcaaatg 121 acttgtgcct tggcctgcag tccctcagtc tgacaggctg ggaccgaccc tggagcaccc 181 aggactcaga ttcctcagcc cagagcagca cacactcggt actgagcatg ctccataacc 241 cactgggaaa tgtcctagga aaacccccct tgagcttcct gcctctggat ccccttgggt 301 ctgacttggt ggacaagttt ccagcaccct cagttagagg atcacgcctg gacacccggc 361 ccatcctgga ctctcgatct agcagcccct ctgactcaga caccagtggc ttcagctctg 421 gatcagatca tctctcagat ttgatttcaa gccttcgcat ttctccacct ctgcccttcc 481 tgtctctgtc agggggtggt cccagagacc ctttaaagat gggggtaggg tctcggatgg 541 accaagagca agctgctctt gctgcagtca ctccctcccc aaccagtgct tcaaagagat 601 ggccaggagc ttctgtgtgg ccatcctggg acctcctcga agctcccaaa gaccccttca 661 gcatagagag agaggccagg ctgcaccgac aagctgcagc tgtgaatgaa gccacctgta 721 cctggagtgg ccagcttcct ccccggaact ataagaaccc catctactct tgcaaggtgt 781 ttctaggagg tgttccttgg gatattacag aagctggatt agttaacacc ttccgtgttt 841 ttggctcttt gagtgtggag tggcctggta aggatggcaa gcatccccgg tgtcctccca 901 aagggtatgt gtatctggtc ttcgaactag agaagtctgt ccgatccttg cttcaggctt 961 gctctcatga cccgctgagc ccagatggcc tgagtgaata ttatttcaag atgtccagcc 1021 gaaggatgcg ctgcaaggag gtgcaggtga tcccctgggt attagccgac agtaactttg 1081 tccggagccc atctcagagg cttgacccca gcaggacggt gtttgtcggt gctctgcatg 1141 gaatgctaaa tgctgaggcc ctggcagcca tcttgaacga cctatttggt GGAGTGGTGT 1201 ATGCCGGGAT TGACACAGAT AAGCACAAGT ATCCCATTGG TTCTGGTCGT GTGACTTTCA 1261 ATAACCAACG GAGTTACCTG AAAGCAGTCA GCGCTGCTTT TGTGGAGATC AAAACCACCA 1321 AGTTCACAAA GAAGGTTCAG ATTGACCCCT ACCTGGAAGA TTCTCTGTGT CATATCTGCA 1381 GTTCTCAGCC TGGTCCTTTC TTCTGTCGAG ATCAGGTCTG CTTCAAATAC TTCTGCCGGA 1441 GCTGCTGGCA CTGGCGGCAC AGCATGGAGG GCCTGCGCCA CCACAGCCCC CTGATGCGGA 1501 ACCAGAAGAA CCGAGATTCC AGCTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1561 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1621 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA ACCCGCAACA 1681 TGCCCGGTGG TCAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1741 att