Construct: ORF TRCN0000492172
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020505.2_s317c1
- DNA Barcode:
- ATTCGGGGACAGATACCACACACA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NEK11 (79858)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492172
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001321220.2 | 99.9% | 99.8% | 1463A>T |
| 2 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353023.2 | 99.9% | 99.8% | 1463A>T |
| 3 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_024800.5 | 99.9% | 99.8% | 1463A>T |
| 4 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353024.2 | 99.7% | 99.6% | 519_520insGGA;1460A>T |
| 5 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353025.2 | 99.7% | 99.6% | 519_520insGGA;1460A>T |
| 6 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353027.2 | 94.3% | 94.2% | 1176_1177ins108;1355A>T |
| 7 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001321221.2 | 93.8% | 93.7% | 335_460del;1589A>T |
| 8 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353022.2 | 93.8% | 93.7% | 335_460del;1589A>T |
| 9 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_017007206.1 | 93.8% | 93.7% | 335_460del;1589A>T |
| 10 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_017007207.1 | 93.8% | 93.7% | 335_460del;1589A>T |
| 11 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_017007208.1 | 93.8% | 93.7% | 335_460del;1589A>T |
| 12 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_017007209.1 | 93.8% | 93.7% | 335_460del;1589A>T |
| 13 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_017007210.1 | 93.8% | 93.7% | 335_460del;1589A>T |
| 14 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001146003.2 | 92.8% | 81.1% | 1463A>T;1621_1622ins97;1797_1798ins41 |
| 15 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353028.2 | 92.8% | 81.1% | 1463A>T;1621_1622ins97;1797_1798ins41 |
| 16 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353029.2 | 92.8% | 81.1% | 1463A>T;1621_1622ins97;1797_1798ins41 |
| 17 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353030.2 | 87.2% | 75.8% | (many diffs) |
| 18 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353031.2 | 87.2% | 75.8% | (many diffs) |
| 19 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353026.2 | 87.1% | 76.3% | (many diffs) |
| 20 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_024453755.1 | 87.1% | 76.3% | (many diffs) |
| 21 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001321222.2 | 83.6% | 83.5% | 647_648ins315;1148A>T |
| 22 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353032.2 | 83.6% | 83.5% | 647_648ins315;1148A>T |
| 23 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_024453756.1 | 83.6% | 83.5% | 647_648ins315;1148A>T |
| 24 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353033.2 | 82.9% | 82.4% | (many diffs) |
| 25 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353034.2 | 82.9% | 82.4% | (many diffs) |
| 26 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_017007219.1 | 82.9% | 82.4% | (many diffs) |
| 27 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353036.2 | 82.8% | 71.6% | (many diffs) |
| 28 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353037.2 | 78% | 77.9% | 647_648ins315;861_862ins108;1040A>T |
| 29 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_024453757.1 | 78% | 77.9% | 647_648ins315;861_862ins108;1040A>T |
| 30 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353038.2 | 77% | 76.8% | 0_1ins444;1019A>T |
| 31 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353039.2 | 77% | 76.8% | 0_1ins444;1019A>T |
| 32 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353040.2 | 77% | 76.8% | 0_1ins444;1019A>T |
| 33 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353041.2 | 77% | 76.8% | 0_1ins444;1019A>T |
| 34 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353042.2 | 77% | 76.8% | 0_1ins444;1019A>T |
| 35 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353043.2 | 77% | 76.8% | 0_1ins444;1019A>T |
| 36 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_011513173.1 | 77% | 76.8% | 0_1ins444;1019A>T |
| 37 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_011513174.1 | 77% | 76.8% | 0_1ins444;1019A>T |
| 38 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_011513175.1 | 77% | 76.8% | 0_1ins444;1019A>T |
| 39 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_017007228.1 | 77% | 76.8% | 0_1ins444;1019A>T |
| 40 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_024453758.1 | 77% | 76.8% | 0_1ins444;1019A>T |
| 41 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_024453759.1 | 77% | 76.8% | 0_1ins444;1019A>T |
| 42 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353044.2 | 76.5% | 65.5% | (many diffs) |
| 43 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353045.2 | 76.5% | 65.5% | (many diffs) |
| 44 | human | 79858 | NEK11 | NIMA related kinase 11 | XR_001740271.1 | 76.3% | (many diffs) | |
| 45 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001321223.1 | 73.8% | 72.6% | (many diffs) |
| 46 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_145910.4 | 72.5% | 72.2% | (many diffs) |
| 47 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_024453760.1 | 71.7% | 71.6% | 0_1ins546;917A>T |
| 48 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001321224.2 | 71.4% | 71.3% | 0_1ins444;732_733ins108;911A>T |
| 49 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353046.2 | 71.4% | 71.3% | 0_1ins444;732_733ins108;911A>T |
| 50 | human | 79858 | NEK11 | NIMA related kinase 11 | NM_001353048.2 | 69.8% | 59.1% | (many diffs) |
| 51 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_017007233.2 | 69.8% | 59.1% | (many diffs) |
| 52 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_017007221.1 | 69.3% | 68.1% | (many diffs) |
| 53 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_017007220.1 | 69.3% | 68.1% | (many diffs) |
| 54 | human | 79858 | NEK11 | NIMA related kinase 11 | XM_017007222.1 | 68.1% | 67.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2007
- ORF length:
- 1935
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgctgaaa ttccaagagg cagctaagtg tgtgagtgga tcaacagcca 121 tttccactta tccaaagacc ttgattgcaa gaagatacgt gcttcaacaa aaacttggca 181 gtggaagttt tggaactgtc tatctggttt cagacaagaa agccaaacga ggagaggaat 241 taaaggtact taaggaaata tctgttggag aactaaatcc aaatgaaact gtacaggcca 301 atttggaagc ccaactcctc tccaagctgg accacccagc cattgtcaag ttccatgcaa 361 gttttgtgga gcaagataat ttctgcatta tcacggagta ctgtgagggc cgagatctgg 421 acgataaaat tcaggaatat aaacaagctg gaaaaatctt tccagaaaat caaataatag 481 aatggtttat ccagctgctg ctgggagttg actacatgca tgagaggagg atacttcatc 541 gagacttaaa gtcaaagaat gtatttctga aaaataatct ccttaaaatt ggagattttg 601 gagtttctcg acttctaatg ggatcctgtg acctggccac aactttaact ggaactcccc 661 attatatgag tcctgaggct ctgaaacacc aaggctatga cacaaagtcg gacatctggt 721 cactggcatg cattttgtat gagatgtgct gcatgaatca tgcattcgct ggctccaatt 781 tcttatccat tgttttaaaa attgttgaag gtgacacacc ttctctccct gagagatatc 841 caaaagaact aaatgccatc atggaaagca tgttgaacaa gaatccttca ttaagaccat 901 ctgctatcga aattttaaaa atcccttacc ttgatgagca gctacagaac ctaatgtgta 961 gatattcaga aatgactctg gaagacaaaa atttggattg tcagaaggag gctgctcata 1021 taattaatgc catgcaaaaa aggatccacc tgcagactct gagggcactg tcagaagtac 1081 agaaaatgac gccaagagaa aggatgcggc tgaggaagct ccaggcggct gatgagaaag 1141 ccaggaagct gaaaaagatt gtggaagaaa aatatgaaga aaatagcaaa cgaatgcaag 1201 aattgagatc tcggaacttt cagcagctga gtgttgatgt actccatgaa aaaacacatt 1261 taaaaggaat ggaagaaaag gaggagcaac ctgagggaag actttcttgt tcaccccagg 1321 acgaggatga agagaggtgg caaggcaggg aagaggaatc tgatgaacca actttagaga 1381 acctgcctga gtctcagcct attccttcca tggacctcca cgaacttgaa tcaattgtag 1441 aggatgccac atctgacctt ggataccatg agatcccaga agacccactt gtggctgaag 1501 agtactacgc tgatgcattt gattcctatt gtgtagagag tgatgaggag gaagaagaaa 1561 tagcgttaga aagaccagag aaagaaatca ggaatgaggg atcccagcct gcttacagaa 1621 caaaccaaca ggacagtgat atcgaagcgt tggccaggtg tttggaaaat gtcctgggtt 1681 gcacttctct agacacaaag accatcacca ccatggctga agacatgtcc ccaggaccac 1741 caattttcaa cagtgtgatg gccaggacca agatgaaacg catgaGGGAA TCAGCCATGC 1801 AGAAGCTGGG GACAGAAGTA TTTGAAGAGG TCTATAATTA CCTCAAGAGA GCAAGGCATC 1861 AGAATGCTAG CGAAGCAGAG ATCCGCGAGT GTTTGGAAAA AGTGGTGCCT CAAGCCAGCG 1921 ACTGTTTTGA AGTGGACCAG CTCCTGTACT TTGAAGAGCA GTTGCTGATC ACGATGGGAA 1981 AAGAACCTAC TCTCCAGAAC CATCTCTAGG ACCCAGCTTT CTTGTACAAA GTGGTTGATA 2041 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 2101 CGTAACTTGA AAGTATTTCG ATTTCTGGCT TTATATATCT TGTGGAAAGG ACGAATTCGG 2161 GGACAGATAC CACACACAAC GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt 2221 gaaagatt