Transcript: Human NM_001321224.2

Homo sapiens NIMA related kinase 11 (NEK11), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
NEK11 (79858)
Length:
2579
CDS:
505..1890

Additional Resources:

NCBI RefSeq record:
NM_001321224.2
NBCI Gene record:
NEK11 (79858)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001965 CCTTACCTTGATGAGCAGCTA pLKO.1 913 CDS 100% 2.640 2.112 N NEK11 n/a
2 TRCN0000196552 GAACCTAATGTGTAGATATTC pLKO.1 936 CDS 100% 13.200 9.240 N NEK11 n/a
3 TRCN0000195420 CACCAAGGCTATGACACAAAG pLKO.1 676 CDS 100% 10.800 7.560 N NEK11 n/a
4 TRCN0000197110 GCCTATGCTTGGAGTCATAAG pLKO.1 2061 3UTR 100% 10.800 7.560 N NEK11 n/a
5 TRCN0000001964 CCATGACTAATAAGGAAGATA pLKO.1 2395 3UTR 100% 5.625 3.938 N NEK11 n/a
6 TRCN0000001962 CCAGAGAAAGAAATCAGGAAT pLKO.1 1456 CDS 100% 4.950 3.465 N NEK11 n/a
7 TRCN0000001963 GCGTTAGAAAGACCAGAGAAA pLKO.1 1444 CDS 100% 4.950 3.465 N NEK11 n/a
8 TRCN0000001961 CCAAACGAGGAGAGGAATTAA pLKO.1 378 5UTR 100% 15.000 10.500 N NEK11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492172 ATTCGGGGACAGATACCACACACA pLX_317 11.9% 71.4% 71.3% V5 (not translated due to prior stop codon) 0_1ins444;732_733ins108;911A>T n/a
2 TRCN0000492116 ATGACATGCCTCATGTTCAACCCG pLX_317 21.2% 71.3% 71.2% V5 (many diffs) n/a
3 ccsbBroadEn_12637 pDONR223 100% 45.4% 44.1% None (many diffs) n/a
4 ccsbBroad304_12637 pLX_304 0% 45.4% 44.1% V5 (many diffs) n/a
5 TRCN0000479883 TGAGCAGACTTAGGCATAAAATCC pLX_317 21.7% 45.4% 44.1% V5 (many diffs) n/a
6 ccsbBroadEn_15155 pDONR223 0% 45.4% 44.1% None (many diffs) n/a
7 ccsbBroad304_15155 pLX_304 0% 45.4% 44.1% V5 (many diffs) n/a
8 TRCN0000480956 CCGAAGCATACCGGTGCCTATACC pLX_317 32.6% 45.4% 44.1% V5 (many diffs) n/a
Download CSV