Transcript: Human NM_001146003.2

Homo sapiens NIMA related kinase 11 (NEK11), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
NEK11 (79858)
Length:
2756
CDS:
227..2026

Additional Resources:

NCBI RefSeq record:
NM_001146003.2
NBCI Gene record:
NEK11 (79858)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146003.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001965 CCTTACCTTGATGAGCAGCTA pLKO.1 1079 CDS 100% 2.640 2.112 N NEK11 n/a
2 TRCN0000001961 CCAAACGAGGAGAGGAATTAA pLKO.1 378 CDS 100% 15.000 10.500 N NEK11 n/a
3 TRCN0000196552 GAACCTAATGTGTAGATATTC pLKO.1 1102 CDS 100% 13.200 9.240 N NEK11 n/a
4 TRCN0000195420 CACCAAGGCTATGACACAAAG pLKO.1 842 CDS 100% 10.800 7.560 N NEK11 n/a
5 TRCN0000197110 GCCTATGCTTGGAGTCATAAG pLKO.1 2238 3UTR 100% 10.800 7.560 N NEK11 n/a
6 TRCN0000001964 CCATGACTAATAAGGAAGATA pLKO.1 2572 3UTR 100% 5.625 3.938 N NEK11 n/a
7 TRCN0000001962 CCAGAGAAAGAAATCAGGAAT pLKO.1 1730 CDS 100% 4.950 3.465 N NEK11 n/a
8 TRCN0000001963 GCGTTAGAAAGACCAGAGAAA pLKO.1 1718 CDS 100% 4.950 3.465 N NEK11 n/a
9 TRCN0000196426 GTTGGAGAACTAAATCCAAAT pLKO.1 419 CDS 100% 1.080 0.756 N NEK11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146003.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492172 ATTCGGGGACAGATACCACACACA pLX_317 11.9% 92.8% 81.1% V5 (not translated due to prior stop codon) 1463A>T;1621_1622ins97;1797_1798ins41 n/a
2 TRCN0000492116 ATGACATGCCTCATGTTCAACCCG pLX_317 21.2% 92.7% 81% V5 1463A>T;1621_1622ins97;1797_1798ins42 n/a
3 ccsbBroadEn_12637 pDONR223 100% 79.5% 78.1% None (many diffs) n/a
4 ccsbBroad304_12637 pLX_304 0% 79.5% 78.1% V5 (many diffs) n/a
5 TRCN0000479883 TGAGCAGACTTAGGCATAAAATCC pLX_317 21.7% 79.5% 78.1% V5 (many diffs) n/a
6 ccsbBroadEn_15155 pDONR223 0% 79.5% 78.1% None (many diffs) n/a
7 ccsbBroad304_15155 pLX_304 0% 79.5% 78.1% V5 (many diffs) n/a
8 TRCN0000480956 CCGAAGCATACCGGTGCCTATACC pLX_317 32.6% 79.5% 78.1% V5 (many diffs) n/a
Download CSV