Construct: ORF TRCN0000492244
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009736.1_s317c1
- Derived from:
- ccsbBroadEn_02978
- DNA Barcode:
- GCGCCTCCCCGGCGTCCGTGGCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AP3M1 (26985)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492244
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26985 | AP3M1 | adaptor related protein com... | NM_001320263.2 | 100% | 100% | |
| 2 | human | 26985 | AP3M1 | adaptor related protein com... | NM_001320264.2 | 100% | 100% | |
| 3 | human | 26985 | AP3M1 | adaptor related protein com... | NM_012095.6 | 100% | 100% | |
| 4 | human | 26985 | AP3M1 | adaptor related protein com... | NM_207012.4 | 100% | 100% | |
| 5 | human | 26985 | AP3M1 | adaptor related protein com... | XM_024447939.1 | 100% | 100% | |
| 6 | human | 26985 | AP3M1 | adaptor related protein com... | NM_001320265.2 | 87% | 87% | 282_283ins162 |
| 7 | human | 26985 | AP3M1 | adaptor related protein com... | NR_135191.2 | 25.5% | 1_77del;1089_1110del;1354_4911del | |
| 8 | human | 26985 | AP3M1 | adaptor related protein com... | XR_001747091.2 | 22.7% | 1_442del;1454_1475del;1719_5519del | |
| 9 | human | 26985 | AP3M1 | adaptor related protein com... | XR_001747092.2 | 22.1% | 1_580del;1592_1613del;1857_5657del | |
| 10 | mouse | 55946 | Ap3m1 | adaptor-related protein com... | NM_018829.4 | 92.9% | 99.5% | (many diffs) |
| 11 | mouse | 55946 | Ap3m1 | adaptor-related protein com... | XM_006519292.1 | 92.9% | 99.5% | (many diffs) |
| 12 | mouse | 55946 | Ap3m1 | adaptor-related protein com... | XM_006519293.1 | 92.9% | 99.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1320
- ORF length:
- 1254
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat ccacagtcta tttctcataa actgttccgg tgacatattt ctagagaagc 121 actggaagag cgttgtgagc cagtctgtct gtgattattt ctttgaagct caagagaaag 181 ctgctgatgt tgaaaatgta ccacctgtca tttcaacacc tcaccactac ctcatcagta 241 tctaccggga taagctcttc tttgtatctg tcatacagac cgaagtgcca cctctctttg 301 taattgagtt cctacatcga gttgctgaca cttttcagga ctactttggt gagtgttcag 361 aggctgcaat taaggataat gtggtcatag tatatgaact cttagaagaa atgttagaca 421 atggatttcc actggctacc gaatctaaca ttttgaaaga attgattaaa ccaccaacaa 481 ttctacgctc tgttgtcaac tctattacag gcagtagtaa tgttggggac acactcccca 541 ccgggcagct gtccaacata ccatggcgtc gggcaggggt aaagtacaca aacaatgaag 601 cctattttga tgttgttgaa gaaatagacg caattataga taaatcagga tctacagtct 661 ttgcagaaat tcagggggtc attgatgctt gcattaaact atctggaatg cctgatctct 721 ccctttcttt catgaaccct aggcttctgg atgatgtcag ctttcacccc tgcatccggt 781 tcaagcgttg ggaatctgaa agagttttgt catttattcc tccagatgga aatttccgac 841 tcatatcata ccgtgtcagc tcacaaaatc tagtggcaat accagtgtat gtgaaacata 901 gtatcagctt taaggagaac agttcttgcg gcagatttGA TATAACAATT GGACCAAAGC 961 AGAATATGGG GAAAACTATT GAAGGAATTA CAGTGACAGT TCACATGCCA AAAGTTGTGC 1021 TGAACATGAA CCTGACACCC ACACAAGGCA GCTATACATT TGATCCAGTC ACCAAGGTAC 1081 TAACATGGGA TGTGGGAAAA ATTACTCCAC AAAAGCTCCC AAGTCTTAAA GGACTGGTAA 1141 ATTTACAGTC TGGAGCCCCC AAACCAGAAG AGAATCCGAG CCTCAACATA CAGTTTAAGA 1201 TCCAGCAGCT TGCTATTTCA GGCTTAAAAG TAAACCGTTT GGACATGTAT GGGGAGAAAT 1261 ATAAGCCATT TAAAGGAGTC AAATACGTCA CGAAAGCTGG AAAGTTCCAA GTGAGGACAT 1321 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1381 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1441 TTTATATATC TTGTGGAAAG GACGAGCGCC TCCCCGGCGT CCGTGGCCAA CGCGTTAAGT 1501 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt