Transcript: Human NM_001320264.2

Homo sapiens adaptor related protein complex 3 subunit mu 1 (AP3M1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
AP3M1 (26985)
Length:
5309
CDS:
498..1754

Additional Resources:

NCBI RefSeq record:
NM_001320264.2
NBCI Gene record:
AP3M1 (26985)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320264.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416627 TCCAGTCACCAAGGTACTAAC pLKO_005 1496 CDS 100% 10.800 15.120 N AP3M1 n/a
2 TRCN0000065101 CCAACAATTCTACGCTCTGTT pLKO.1 906 CDS 100% 4.950 6.930 N AP3M1 n/a
3 TRCN0000420255 GCCAGTCTGTCTGTGATTATT pLKO_005 571 CDS 100% 15.000 10.500 N AP3M1 n/a
4 TRCN0000430284 ATGGAAATTTCCGACTCATAT pLKO_005 1258 CDS 100% 13.200 9.240 N AP3M1 n/a
5 TRCN0000421847 GATAATGTGGTCATAGTATAT pLKO_005 807 CDS 100% 13.200 9.240 N AP3M1 n/a
6 TRCN0000111662 GCTTGCTATTTCAGGCTTAAA pLKO.1 1640 CDS 100% 13.200 9.240 N Ap3m1 n/a
7 TRCN0000305487 GGATAATGTGGTCATAGTATA pLKO_005 806 CDS 100% 13.200 9.240 N Ap3m1 n/a
8 TRCN0000417059 TGGCTACCGAATCTAACATTT pLKO_005 865 CDS 100% 13.200 9.240 N AP3M1 n/a
9 TRCN0000425879 AGCTACACACCGCTAACAAAG pLKO_005 1867 3UTR 100% 10.800 7.560 N AP3M1 n/a
10 TRCN0000065099 GCGGCAGATTTGATATAACAA pLKO.1 1360 CDS 100% 5.625 3.938 N AP3M1 n/a
11 TRCN0000065100 CCGAGCCTCAACATACAGTTT pLKO.1 1608 CDS 100% 4.950 3.465 N AP3M1 n/a
12 TRCN0000065102 CGGTGACATATTTCTAGAGAA pLKO.1 530 CDS 100% 4.950 3.465 N AP3M1 n/a
13 TRCN0000065098 GCCTCATTAGACATCAAGAAA pLKO.1 3096 3UTR 100% 5.625 3.375 N AP3M1 n/a
14 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4766 3UTR 100% 4.950 2.475 Y CFLAR n/a
15 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4766 3UTR 100% 4.950 2.475 Y C19orf31 n/a
16 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4805 3UTR 100% 4.050 2.025 Y P3H4 n/a
17 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4805 3UTR 100% 4.050 2.025 Y ORAI2 n/a
18 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4805 3UTR 100% 4.050 2.025 Y P3H4 n/a
19 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4932 3UTR 100% 10.800 5.400 Y SMIM11A n/a
20 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4764 3UTR 100% 4.950 2.475 Y ERN2 n/a
21 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4764 3UTR 100% 4.950 2.475 Y P3H4 n/a
22 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4764 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320264.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02978 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02978 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492244 GCGCCTCCCCGGCGTCCGTGGCCA pLX_317 30.7% 100% 100% V5 n/a
Download CSV