Transcript: Human XR_001747092.2

PREDICTED: Homo sapiens adaptor related protein complex 3 subunit mu 1 (AP3M1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AP3M1 (26985)
Length:
5657
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747092.2
NBCI Gene record:
AP3M1 (26985)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747092.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065101 CCAACAATTCTACGCTCTGTT pLKO.1 989 3UTR 100% 4.950 6.930 N AP3M1 n/a
2 TRCN0000420255 GCCAGTCTGTCTGTGATTATT pLKO_005 654 3UTR 100% 15.000 10.500 N AP3M1 n/a
3 TRCN0000430284 ATGGAAATTTCCGACTCATAT pLKO_005 1341 3UTR 100% 13.200 9.240 N AP3M1 n/a
4 TRCN0000421847 GATAATGTGGTCATAGTATAT pLKO_005 890 3UTR 100% 13.200 9.240 N AP3M1 n/a
5 TRCN0000111662 GCTTGCTATTTCAGGCTTAAA pLKO.1 1745 3UTR 100% 13.200 9.240 N Ap3m1 n/a
6 TRCN0000305487 GGATAATGTGGTCATAGTATA pLKO_005 889 3UTR 100% 13.200 9.240 N Ap3m1 n/a
7 TRCN0000417059 TGGCTACCGAATCTAACATTT pLKO_005 948 3UTR 100% 13.200 9.240 N AP3M1 n/a
8 TRCN0000425879 AGCTACACACCGCTAACAAAG pLKO_005 1972 3UTR 100% 10.800 7.560 N AP3M1 n/a
9 TRCN0000065099 GCGGCAGATTTGATATAACAA pLKO.1 1443 3UTR 100% 5.625 3.938 N AP3M1 n/a
10 TRCN0000065100 CCGAGCCTCAACATACAGTTT pLKO.1 1713 3UTR 100% 4.950 3.465 N AP3M1 n/a
11 TRCN0000065102 CGGTGACATATTTCTAGAGAA pLKO.1 613 3UTR 100% 4.950 3.465 N AP3M1 n/a
12 TRCN0000065098 GCCTCATTAGACATCAAGAAA pLKO.1 3201 3UTR 100% 5.625 3.375 N AP3M1 n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4871 3UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4871 3UTR 100% 4.950 2.475 Y C19orf31 n/a
15 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4910 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4910 3UTR 100% 4.050 2.025 Y ORAI2 n/a
17 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4910 3UTR 100% 4.050 2.025 Y P3H4 n/a
18 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5037 3UTR 100% 10.800 5.400 Y SMIM11A n/a
19 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4869 3UTR 100% 4.950 2.475 Y ERN2 n/a
20 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4869 3UTR 100% 4.950 2.475 Y P3H4 n/a
21 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4869 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747092.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02978 pDONR223 100% 22.1% None 1_580del;1592_1613del;1857_5657del n/a
2 ccsbBroad304_02978 pLX_304 0% 22.1% V5 1_580del;1592_1613del;1857_5657del n/a
3 TRCN0000492244 GCGCCTCCCCGGCGTCCGTGGCCA pLX_317 30.7% 22.1% V5 1_580del;1592_1613del;1857_5657del n/a
Download CSV