Construct: ORF TRCN0000492360
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009900.1_s317c1
- Derived from:
- ccsbBroadEn_01121
- DNA Barcode:
- GTCATAAACCAAACCCATAGAACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OPRL1 (4987)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492360
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_000913.6 | 100% | 100% | |
| 2 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_001200019.2 | 100% | 100% | |
| 3 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_182647.4 | 100% | 100% | |
| 4 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_017027854.1 | 100% | 100% | |
| 5 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_001318854.1 | 98.6% | 98.6% | 218_219insGTACGTCATCCTCAG |
| 6 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_017027855.1 | 98.6% | 98.6% | 218_219insGTACGTCATCCTCAG |
| 7 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_011528828.3 | 95.3% | 95.3% | 1_54del |
| 8 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_017027853.1 | 95.3% | 95.3% | 1_54del |
| 9 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_001318853.2 | 92.7% | 100% | 1111_1197del |
| 10 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_001318855.1 | 87.4% | 80.6% | 0_1ins115;118_145del |
| 11 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_011528830.3 | 78.1% | 78.1% | 0_1ins243 |
| 12 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001252565.1 | 85.3% | 93.7% | (many diffs) |
| 13 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_011012.5 | 85.3% | 93.7% | (many diffs) |
| 14 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316323.1 | 85.3% | 93.7% | (many diffs) |
| 15 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316325.1 | 85.3% | 93.7% | (many diffs) |
| 16 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318920.1 | 84.1% | 92.4% | (many diffs) |
| 17 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_006500582.2 | 84.1% | 92.4% | (many diffs) |
| 18 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318919.1 | 79.2% | 93.7% | (many diffs) |
| 19 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318923.1 | 78.5% | 77.3% | (many diffs) |
| 20 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318922.1 | 77.9% | 76.3% | (many diffs) |
| 21 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318924.1 | 67.9% | 75.4% | (many diffs) |
| 22 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318925.1 | 67.9% | 75.4% | (many diffs) |
| 23 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_006500584.2 | 67.9% | 75.4% | (many diffs) |
| 24 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316326.1 | 67.9% | 75.4% | (many diffs) |
| 25 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316328.1 | 67.9% | 75.4% | (many diffs) |
| 26 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316329.1 | 67.9% | 75.4% | (many diffs) |
| 27 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316330.1 | 67.9% | 75.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1176
- ORF length:
- 1110
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gcccctcttc cccgcgccgt tctgggaggt tatctacggc agccaccttc 121 agggcaacct gtccctcctg agccccaacc acagtctgct gcccccgcat ctgctgctca 181 atgccagcca cggcgccttc ctgcccctcg ggctcaaggt caccatcgtg gggctctacc 241 tggccgtgtg tgtcggaggg ctcctgggga actgccttgt catgtacgtc atcctcaggc 301 acaccaaaat gaagacagcc accaatattt acatctttaa cctggccctg gccgacactc 361 tggtcctgct gacgctgccc ttccagggca cggacatcct cctgggcttc tggccgtttg 421 ggaatgcgct gtgcaagaca gtcattgcca ttgactacta caacatgttc accagcacct 481 tcaccctaac tgccatgagt gtggatcgct atgtagccat ctgccacccc atccgtgccc 541 tcgacgtccg cacgtccagc aaagcccagg ctgtcaatgt ggccatctgg gccctggcct 601 ctgttgtcgg tgttcccgtt gccatcatgg gctcggcaca ggtcgaggat gaagagatcg 661 agtgcctggt ggagatccct acccctcagg attactgggg cccggtgttt gccatctgca 721 tcttcctctt ctccttcatc gtccccgtgc tcgtcatctc tgtctgctac agcctcatga 781 tccGGCGGCT CCGTGGAGTC CGCCTGCTCT CGGGCTCCCG AGAGAAGGAC CGGAACCTGC 841 GGCGCATCAC TCGGCTGGTG CTGGTGGTAG TGGCTGTGTT CGTGGGCTGC TGGACGCCTG 901 TCCAGGTCTT CGTGCTGGCC CAAGGGCTGG GGGTTCAGCC GAGCAGCGAG ACTGCCGTGG 961 CCATTCTGCG CTTCTGCACG GCCCTGGGCT ACGTCAACAG CTGCCTCAAC CCCATCCTCT 1021 ACGCCTTCCT GGATGAGAAC TTCAAGGCCT GCTTCCGCAA GTTCTGCTGT GCATCTGCCC 1081 TGCGCCGGGA CGTGCAGGTG TCTGACCGCG TGCGCAGCAT TGCCAAGGAC GTGGCCCTGG 1141 CCTGCAAGAC CTCTGAGACG GTACCGCGGC CCGCATGCCC AACTTTCTTG TACAAAGTGG 1201 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1261 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1321 AGTCATAAAC CAAACCCATA GAACCACGCG TTAAGTCgac aatcaacctc tggattacaa 1381 aatttgtgaa agatt