Transcript: Human NM_000189.5

Homo sapiens hexokinase 2 (HK2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
HK2 (3099)
Length:
5626
CDS:
455..3208

Additional Resources:

NCBI RefSeq record:
NM_000189.5
NBCI Gene record:
HK2 (3099)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001162355 GCGGACTTCCTCGAGTACAT pXPR_003 GGG 1763 64% 12 1.1455 HK2 HK2 76311
2 BRDN0001149267 GTCCGGGGTAGCACACACGT pXPR_003 AGG 1546 56% 10 0.9259 HK2 HK2 76312
3 BRDN0001162212 GTCTACATAAGACCGTGCGG pXPR_003 CGG 1293 47% 10 0.722 HK2 HK2 76310
4 BRDN0001162236 TCAGATCTATGCCATCCCTG pXPR_003 AGG 343 12% 3 0.2363 HK2 HK2 76309
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000189.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232928 CTTAGGGCAGTCAGTAGTATT pLKO_005 4449 3UTR 100% 13.200 18.480 N HK2 n/a
2 TRCN0000037670 CCGTAACATTCTCATCGATTT pLKO.1 2716 CDS 100% 10.800 15.120 N HK2 n/a
3 TRCN0000232926 CCGTAACATTCTCATCGATTT pLKO_005 2716 CDS 100% 10.800 15.120 N HK2 n/a
4 TRCN0000232925 GGGACTTTGATATCGACATTG pLKO_005 1044 CDS 100% 10.800 15.120 N HK2 n/a
5 TRCN0000196724 GACTTTGATATCGACATTGTG pLKO.1 1046 CDS 100% 4.950 6.930 N HK2 n/a
6 TRCN0000195171 CTTCATGGATAAGCTACAAAT pLKO.1 862 CDS 100% 13.200 9.240 N HK2 n/a
7 TRCN0000232927 TGACGACAGCATCATTGTTAA pLKO_005 2893 CDS 100% 13.200 9.240 N HK2 n/a
8 TRCN0000195582 CCAAAGACATCTCAGACATTG pLKO.1 1461 CDS 100% 10.800 7.560 N HK2 n/a
9 TRCN0000232924 GGGTGAAAGTAACGGACAATG pLKO_005 735 CDS 100% 10.800 7.560 N HK2 n/a
10 TRCN0000037671 ACTGAGTTTGACCAGGAGATT pLKO.1 1277 CDS 100% 4.950 3.465 N HK2 n/a
11 TRCN0000037672 CACTGTGAAGTTGGCCTCATT pLKO.1 2465 CDS 100% 4.950 3.465 N HK2 n/a
12 TRCN0000199344 CGAGCCATCCTGCAACACTTA pLKO.1 2855 CDS 100% 4.950 3.465 N HK2 n/a
13 TRCN0000197099 GCAGAAGGTTGACCAGTATCT pLKO.1 511 CDS 100% 4.950 3.465 N HK2 n/a
14 TRCN0000037669 GCCTGGCTAACTTCATGGATA pLKO.1 852 CDS 100% 4.950 3.465 N HK2 n/a
15 TRCN0000037673 GCTACAAATCAAAGACAAGAA pLKO.1 874 CDS 100% 4.950 3.465 N HK2 n/a
16 TRCN0000195340 CCAGAAGACATTAGAGCATCT pLKO.1 1864 CDS 100% 4.050 2.835 N HK2 n/a
17 TRCN0000199240 CCCAGCTGTTTGACCACATTG pLKO.1 825 CDS 100% 10.800 6.480 N HK2 n/a
18 TRCN0000196260 GCTTGAAGATTAGGTACTATC pLKO.1 5266 3UTR 100% 10.800 6.480 N HK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000189.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14667 pDONR223 0% 99.9% 100% None 2298A>G n/a
2 ccsbBroad304_14667 pLX_304 0% 99.9% 100% V5 2298A>G n/a
3 TRCN0000467008 CCTAATCTACTCTTGTATTGAAAG pLX_317 13.4% 99.9% 100% V5 2298A>G n/a
4 TRCN0000488991 TATGTTCAGGTTCGCAGAACGATA pLX_317 11.8% 99.9% 100% V5 (not translated due to prior stop codon) 2298A>G n/a
5 ccsbBroadEn_14666 pDONR223 54.9% 99.4% 99.2% None (many diffs) n/a
6 ccsbBroad304_14666 pLX_304 0% 99.4% 99.2% V5 (many diffs) n/a
7 TRCN0000480635 ATATTCCAATAGCCCATCCGTAAT pLX_317 16% 99.4% 99.2% V5 (many diffs) n/a
Download CSV