Transcript: Human NM_000252.2

Homo sapiens myotubularin 1 (MTM1), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
MTM1 (4534)
Length:
3452
CDS:
77..1888

Additional Resources:

NCBI RefSeq record:
NM_000252.2
NBCI Gene record:
MTM1 (4534)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000252.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355941 CCGCATTAGAGCTCGAAATAA pLKO_005 1904 3UTR 100% 15.000 21.000 N MTM1 n/a
2 TRCN0000355943 GCATTGAAGGGTTCGAAATAC pLKO_005 1272 CDS 100% 13.200 18.480 N MTM1 n/a
3 TRCN0000002421 CGGTATGAGTGGGAAACGAAA pLKO.1 817 CDS 100% 4.950 6.930 N MTM1 n/a
4 TRCN0000002420 GACGAATACATAAAGCGGCTT pLKO.1 1769 CDS 100% 2.160 3.024 N MTM1 n/a
5 TRCN0000368439 TATGAGTGGGAAACGAAATAA pLKO_005 820 CDS 100% 15.000 10.500 N MTM1 n/a
6 TRCN0000355945 TGTTATCAGGGAGACTAATAA pLKO_005 862 CDS 100% 15.000 10.500 N MTM1 n/a
7 TRCN0000331439 CATCACAAATTATCGTCTTTA pLKO_005 268 CDS 100% 13.200 9.240 N Mtm1 n/a
8 TRCN0000355882 CATCACAAATTATCGTCTTTA pLKO_005 268 CDS 100% 13.200 9.240 N MTM1 n/a
9 TRCN0000002418 GACATCTCAAATACAGTAGTA pLKO.1 3203 3UTR 100% 4.950 3.465 N MTM1 n/a
10 TRCN0000002419 GCCATTCAAGTAGCAGACAAA pLKO.1 1145 CDS 100% 4.950 3.465 N MTM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000252.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06602 pDONR223 100% 99.9% 99.8% None 1228G>A n/a
2 ccsbBroad304_06602 pLX_304 0% 99.9% 99.8% V5 1228G>A n/a
3 TRCN0000473224 TACAGGCAATACACCTGTCCTGGT pLX_317 28.9% 99.9% 99.8% V5 1228G>A n/a
4 TRCN0000488963 AACAAACATTACAGCATACCTACG pLX_317 19.6% 99.9% 99.8% V5 (not translated due to prior stop codon) 1228G>A n/a
Download CSV