Transcript: Human NM_000288.4

Homo sapiens peroxisomal biogenesis factor 7 (PEX7), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PEX7 (5191)
Length:
1454
CDS:
75..1046

Additional Resources:

NCBI RefSeq record:
NM_000288.4
NBCI Gene record:
PEX7 (5191)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000288.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190269 CAGGAGGTGTATAGTGTTGAT pLKO.1 408 CDS 100% 4.950 6.930 N Pex7 n/a
2 TRCN0000119095 GTGGAGCATCATACAGAGTTT pLKO.1 918 CDS 100% 4.950 6.930 N PEX7 n/a
3 TRCN0000289053 GTGGAGCATCATACAGAGTTT pLKO_005 918 CDS 100% 4.950 6.930 N PEX7 n/a
4 TRCN0000119096 CTACTAATATTGGATCCAGAT pLKO.1 216 CDS 100% 4.050 5.670 N PEX7 n/a
5 TRCN0000289003 CTACTAATATTGGATCCAGAT pLKO_005 216 CDS 100% 4.050 5.670 N PEX7 n/a
6 TRCN0000119094 GCTCAGGAGGTGTATAGTGTT pLKO.1 405 CDS 100% 4.950 3.960 N PEX7 n/a
7 TRCN0000289055 GCTCAGGAGGTGTATAGTGTT pLKO_005 405 CDS 100% 4.950 3.960 N PEX7 n/a
8 TRCN0000119092 GAACTGCCTAACAGCAAATAA pLKO.1 1087 3UTR 100% 15.000 10.500 N PEX7 n/a
9 TRCN0000289096 GAACTGCCTAACAGCAAATAA pLKO_005 1087 3UTR 100% 15.000 10.500 N PEX7 n/a
10 TRCN0000119093 GCAGGAGTAAGAATCGTGATT pLKO.1 636 CDS 100% 4.950 3.465 N PEX7 n/a
11 TRCN0000289054 GCAGGAGTAAGAATCGTGATT pLKO_005 636 CDS 100% 4.950 3.465 N PEX7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000288.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01173 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01173 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478764 CGAGGCTAAAACTTCAGATCCCCA pLX_317 46.3% 100% 100% V5 n/a
4 ccsbBroadEn_11027 pDONR223 100% 82.3% 78.1% None (many diffs) n/a
5 ccsbBroad304_11027 pLX_304 0% 82.3% 78.1% V5 (many diffs) n/a
6 TRCN0000472179 ACCTCCTGTGCCGAGAAAATGCAC pLX_317 38.2% 82.3% 78.1% V5 (many diffs) n/a
Download CSV