Transcript: Human NM_000329.3

Homo sapiens retinoid isomerohydrolase RPE65 (RPE65), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
RPE65 (6121)
Length:
2605
CDS:
50..1651

Additional Resources:

NCBI RefSeq record:
NM_000329.3
NBCI Gene record:
RPE65 (6121)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000329.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083109 CCTGATTCATACCCATCAGAA pLKO.1 1436 CDS 100% 0.495 0.693 N RPE65 n/a
2 TRCN0000083110 CCCAACCTGAAGTTAGGAGAT pLKO.1 1131 CDS 100% 4.050 3.240 N RPE65 n/a
3 TRCN0000425340 TCATGCAATAAGGCTTAATTA pLKO_005 2070 3UTR 100% 15.000 10.500 N RPE65 n/a
4 TRCN0000428094 ACCGTTTACAATATTGGTAAT pLKO_005 611 CDS 100% 10.800 7.560 N RPE65 n/a
5 TRCN0000433837 CAAGCCATCTTACGTTCATAG pLKO_005 754 CDS 100% 10.800 7.560 N RPE65 n/a
6 TRCN0000083111 GCAGACAAGGAAGATCCAATA pLKO.1 689 CDS 100% 10.800 7.560 N RPE65 n/a
7 TRCN0000083112 CTCCTGCACAAGTTTGACTTT pLKO.1 245 CDS 100% 4.950 3.465 N RPE65 n/a
8 TRCN0000083108 GCCTGCTATATGTCATGGTTT pLKO.1 1734 3UTR 100% 4.950 3.465 N RPE65 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000329.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01415 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01415 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478090 CGTAGCTGACATATCATTGGGGCA pLX_317 19.7% 100% 100% V5 n/a
Download CSV