Transcript: Human NM_000383.4

Homo sapiens autoimmune regulator (AIRE), mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
AIRE (326)
Length:
2690
CDS:
132..1769

Additional Resources:

NCBI RefSeq record:
NM_000383.4
NBCI Gene record:
AIRE (326)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000383.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368659 TTGTCAGTGCTCGGCTGTAAA pLKO_005 1881 3UTR 100% 13.200 10.560 N AIRE n/a
2 TRCN0000018891 CATGGACACGACTCTTGTCTA pLKO.1 1292 CDS 100% 4.950 3.960 N AIRE n/a
3 TRCN0000359406 CCATCATGTGCCTGGAAATTA pLKO_005 1928 3UTR 100% 15.000 10.500 N AIRE n/a
4 TRCN0000359484 TCCTCATCCAGCAGGTGTTTG pLKO_005 757 CDS 100% 10.800 7.560 N AIRE n/a
5 TRCN0000359485 ACTACAACCTGGAGCGCTATG pLKO_005 382 CDS 100% 6.000 4.200 N AIRE n/a
6 TRCN0000018892 GTTCTACACTCCCAGCAAGTT pLKO.1 818 CDS 100% 4.950 3.465 N AIRE n/a
7 TRCN0000018893 GAGACGCTTCATCTGAAGGAA pLKO.1 264 CDS 100% 3.000 2.100 N AIRE n/a
8 TRCN0000018890 GACAAGTTTCAGGAGACGCTT pLKO.1 252 CDS 100% 2.640 1.848 N AIRE n/a
9 TRCN0000018894 GCCAAGGATGACACTGCCAGT pLKO.1 1629 CDS 100% 0.720 0.432 N AIRE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000383.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05832 pDONR223 100% 59.3% 49.4% None (many diffs) n/a
2 ccsbBroad304_05832 pLX_304 0% 59.3% 49.4% V5 (many diffs) n/a
3 TRCN0000476530 GCATTTTTCTCATATCGAAAGAAT pLX_317 33.4% 59.3% 49.4% V5 (many diffs) n/a
Download CSV