Transcript: Human NM_000402.4

Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
G6PD (2539)
Length:
2406
CDS:
149..1786

Additional Resources:

NCBI RefSeq record:
NM_000402.4
NBCI Gene record:
G6PD (2539)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000402.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221353 GTCGTCCTCTATGTGGAGAAT pLKO.1 1256 CDS 100% 4.950 3.960 N G6PD n/a
2 TRCN0000281207 GTCGTCCTCTATGTGGAGAAT pLKO_005 1256 CDS 100% 4.950 3.960 N G6PD n/a
3 TRCN0000221356 CCCTATATTTATGGCAGCCGA pLKO.1 1679 CDS 100% 0.660 0.528 N G6PD n/a
4 TRCN0000221355 TCAGTCGGATACACACATATT pLKO.1 319 CDS 100% 13.200 9.240 N G6PD n/a
5 TRCN0000281205 TCAGTCGGATACACACATATT pLKO_005 319 CDS 100% 13.200 9.240 N G6PD n/a
6 TRCN0000221354 CAACAGATACAAGAACGTGAA pLKO.1 1513 CDS 100% 4.050 2.835 N G6PD n/a
7 TRCN0000281204 CAACAGATACAAGAACGTGAA pLKO_005 1513 CDS 100% 4.050 2.835 N G6PD n/a
8 TRCN0000221352 GCTGATGAAGAGAGTGGGTTT pLKO.1 1720 CDS 100% 4.050 2.835 N G6PD n/a
9 TRCN0000281206 GCTGATGAAGAGAGTGGGTTT pLKO_005 1720 CDS 100% 4.050 2.835 N G6PD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000402.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06235 pDONR223 100% 94.4% 94.4% None 1_90del n/a
2 ccsbBroad304_06235 pLX_304 0% 94.4% 94.4% V5 1_90del n/a
3 TRCN0000467117 ATGTGTCCCAATCTGATGCATCTC pLX_317 30.1% 94.4% 94.4% V5 1_90del n/a
Download CSV