Transcript: Human NM_000455.4:c.790_793del

NM_000455.4(STK11):c.790_793del

Taxon:
Homo sapiens (human)
Gene:
STK11 (6794)
Length:
3282
CDS:
1116..1970

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000455.4:c.790_793del, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000407 GAGTGTGCGGTCAATATTTAT pLKO.1 3121 3UTR 100% 15.000 21.000 N STK11 n/a
2 TRCN0000199242 CGAGCTGATGTCGGTGGGTAT pLKO.1 1160 CDS 100% 1.350 1.890 N STK11 n/a
3 TRCN0000199195 GCCGTGTGTATGAACGGCACA pLKO.1 2276 3UTR 100% 0.072 0.101 N STK11 n/a
4 TRCN0000000408 GCCAACGTGAAGAAGGAAATT pLKO.1 1392 CDS 100% 13.200 9.240 N STK11 n/a
5 TRCN0000195299 CATTGTGCACAAGGACATCAA pLKO.1 1628 CDS 100% 4.950 3.465 N STK11 n/a
6 TRCN0000000410 GAAGAAGAAGTTGCGAAGGAT pLKO.1 1358 CDS 100% 3.000 2.100 N STK11 n/a
7 TRCN0000199913 GCCAAGCTCATCGGCAAGTAC pLKO.1 1242 CDS 100% 1.650 1.155 N STK11 n/a
8 TRCN0000000409 GATCCTCAAGAAGAAGAAGTT pLKO.1 1349 CDS 100% 4.950 2.970 N STK11 n/a
9 TRCN0000000411 CATCTACACTCAGGACTTCAC pLKO.1 2191 3UTR 100% 4.050 2.430 N STK11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000455.4:c.790_793del, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01613 pDONR223 100% 99.6% 60.6% None 786_787insTTGT n/a
2 TRCN0000479821 TGAGCACCCCATCAACCAGAACCG pLX_317 27.9% 99.6% 60.6% V5 786_787insTTGT n/a
3 ccsbBroad304_01613 pLX_304 50.4% 99.6% 60.6% V5 690C>T;786_787insTTGT n/a
4 ccsbBroadEn_14853 pDONR223 0% 99.6% 60.6% None 786_787insTTGT n/a
5 ccsbBroad304_14853 pLX_304 41.5% 99.6% 60.6% V5 786_787insTTGT n/a
6 TRCN0000480906 TAATCTCTACCGGTACTACACCAA pLX_317 31.2% 99.6% 60.6% V5 786_787insTTGT n/a
7 TRCN0000489078 GTGGTACCGTTCCCTGATGAGAGA pLX_317 28% 99.6% 60.6% V5 (not translated due to prior stop codon) 786_787insTTGT n/a
Download CSV