Transcript: Human NM_000585.5

Homo sapiens interleukin 15 (IL15), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL15 (3600)
Length:
2015
CDS:
388..876

Additional Resources:

NCBI RefSeq record:
NM_000585.5
NBCI Gene record:
IL15 (3600)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000585.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372534 TAAGGGTGATAGTCAAATTAT pLKO_005 1226 3UTR 100% 15.000 10.500 N IL15 n/a
2 TRCN0000378797 CACTCTGCTGCTTAGACATAA pLKO_005 921 3UTR 100% 13.200 9.240 N IL15 n/a
3 TRCN0000372533 CTCTTGGAGTTACAAGTTATT pLKO_005 661 CDS 100% 13.200 9.240 N IL15 n/a
4 TRCN0000372535 GAAGATCTTATTCAATCTATG pLKO_005 568 CDS 100% 10.800 7.560 N IL15 n/a
5 TRCN0000058924 CAGTGCTACTTGTGTTTACTT pLKO.1 427 CDS 100% 5.625 3.938 N IL15 n/a
6 TRCN0000066669 GCTGGCATTCATGTCTTCATT pLKO.1 472 CDS 100% 5.625 3.938 N Il15 n/a
7 TRCN0000058927 TGTCTTCTAATGGGAATGTAA pLKO.1 752 CDS 100% 5.625 3.938 N IL15 n/a
8 TRCN0000058923 GCAAGTATTCATGATACAGTA pLKO.1 700 CDS 100% 4.950 3.465 N IL15 n/a
9 TRCN0000058926 TGGGTGAATGTAATAAGTGAT pLKO.1 535 CDS 100% 4.950 3.465 N IL15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000585.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00863 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00863 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474037 TGAAGACTCCGGAACGTCTCACGG pLX_317 100% 100% 100% V5 n/a
Download CSV