Transcript: Human NM_000766.5

Homo sapiens cytochrome P450 family 2 subfamily A member 13 (CYP2A13), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CYP2A13 (1553)
Length:
1760
CDS:
22..1506

Additional Resources:

NCBI RefSeq record:
NM_000766.5
NBCI Gene record:
CYP2A13 (1553)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000766.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064032 CCAGCACTTCCTGGATAAGAA pLKO.1 1260 CDS 100% 5.625 3.938 N CYP2A13 n/a
2 TRCN0000064028 CATCATGCAGAACTTTCGCTT pLKO.1 1386 CDS 100% 2.640 1.848 N CYP2A13 n/a
3 TRCN0000064029 CCCTGTGTTCACCATTCACTT pLKO.1 219 CDS 100% 4.950 2.970 N CYP2A13 n/a
4 TRCN0000064031 CGGGACTTCATCGACTCCTTT pLKO.1 814 CDS 100% 4.950 2.970 N CYP2A13 n/a
5 TRCN0000415363 TGTTCTCTTCGGTGATGAAAC pLKO_005 686 CDS 100% 10.800 5.400 Y CYP2A6 n/a
6 TRCN0000064030 CCTGACTGTGATGGTCTTGAT pLKO.1 63 CDS 100% 4.950 2.475 Y CYP2A13 n/a
7 TRCN0000064010 CGCTTTGACTATGAGGACAAA pLKO.1 589 CDS 100% 4.950 2.475 Y CYP2A7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000766.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06071 pDONR223 100% 95% 93.5% None (many diffs) n/a
2 ccsbBroad304_06071 pLX_304 0% 95% 93.5% V5 (many diffs) n/a
3 TRCN0000474503 ATGAGCTTTTGGCAGTTCGACCCC pLX_317 5.9% 95% 93.5% V5 (many diffs) n/a
4 ccsbBroadEn_06072 pDONR223 100% 94.6% 92.1% None (many diffs) n/a
5 ccsbBroad304_06072 pLX_304 0% 94.6% 92.1% V5 (many diffs) n/a
6 TRCN0000469732 GGTTTCAAGCCTGTGTATCACCGT pLX_317 27% 94.6% 92.1% V5 (many diffs) n/a
Download CSV