Transcript: Human NM_000784.4

Homo sapiens cytochrome P450 family 27 subfamily A member 1 (CYP27A1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CYP27A1 (1593)
Length:
1895
CDS:
37..1632

Additional Resources:

NCBI RefSeq record:
NM_000784.4
NBCI Gene record:
CYP27A1 (1593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000784.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231144 CAATGTGGATGTCCTACTTAG pLKO_005 317 CDS 100% 10.800 8.640 N CYP27A1 n/a
2 TRCN0000231147 AGCAACTCCCTCTCAGCTAAA pLKO_005 1804 3UTR 100% 10.800 7.560 N CYP27A1 n/a
3 TRCN0000231146 CCACAAACTCCCGGATCATAG pLKO_005 1238 CDS 100% 10.800 7.560 N CYP27A1 n/a
4 TRCN0000231145 TCGTCAGATCCATCGGGTTAA pLKO_005 755 CDS 100% 10.800 7.560 N CYP27A1 n/a
5 TRCN0000062160 CGATACCTGGATGGTTGGAAT pLKO.1 844 CDS 100% 4.950 3.465 N CYP27A1 n/a
6 TRCN0000062162 CGCATTGTCCTGGTTCCCAAT pLKO.1 1573 CDS 100% 4.050 2.835 N CYP27A1 n/a
7 TRCN0000062159 GCACCAGTTACAGGTGCTTTA pLKO.1 279 CDS 100% 1.080 0.756 N CYP27A1 n/a
8 TRCN0000062158 GCTTTCAATGAGGTGATTGAT pLKO.1 565 CDS 100% 0.563 0.394 N CYP27A1 n/a
9 TRCN0000218094 ACTTTGCCTTGGAAGCTATTT pLKO_005 668 CDS 100% 13.200 7.920 N CYP27A1 n/a
10 TRCN0000062161 CAGTTTGTGTTCTGCCACTAT pLKO.1 1303 CDS 100% 4.950 2.970 N CYP27A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000784.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00416 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00416 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467534 CCTAACCTGGAGCCGCCGGTATAT pLX_317 25.1% 100% 100% V5 n/a
Download CSV