Transcript: Human NM_000902.4

Homo sapiens membrane metalloendopeptidase (MME), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MME (4311)
Length:
5618
CDS:
96..2348

Additional Resources:

NCBI RefSeq record:
NM_000902.4
NBCI Gene record:
MME (4311)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000902.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416640 CTAAGGTCTATCAAGTCAATC pLKO_005 2538 3UTR 100% 10.800 15.120 N MME n/a
2 TRCN0000046826 GCATGGTCATAGGACACGAAA pLKO.1 1831 CDS 100% 4.950 6.930 N MME n/a
3 TRCN0000046823 CCAGGCAATTTCAGGATTATT pLKO.1 2235 CDS 100% 15.000 10.500 N MME n/a
4 TRCN0000432138 TAGGTGACACTATAGTTTAAA pLKO_005 2746 3UTR 100% 15.000 10.500 N MME n/a
5 TRCN0000432901 TAATGTCCTGGAGATTCATAA pLKO_005 1204 CDS 100% 13.200 9.240 N MME n/a
6 TRCN0000046827 GCAAGTCATCAGACTGCATAA pLKO.1 265 CDS 100% 10.800 7.560 N MME n/a
7 TRCN0000046825 GCAAACTATGTCAATGGGAAT pLKO.1 1329 CDS 100% 4.050 2.835 N MME n/a
8 TRCN0000046824 GCCAGATTGATTCGTCAGGAA pLKO.1 852 CDS 100% 2.640 1.848 N MME n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000902.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01020 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01020 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475807 TGAGCATTCACCCTCACACGGAAA pLX_317 12% 100% 100% V5 n/a
Download CSV