Transcript: Human NM_000937.5

Homo sapiens RNA polymerase II subunit A (POLR2A), mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
POLR2A (5430)
Length:
6749
CDS:
400..6312

Additional Resources:

NCBI RefSeq record:
NM_000937.5
NBCI Gene record:
POLR2A (5430)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000937.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353676 CCAGCTCCGTTGTACATAAAT pLKO_005 6407 3UTR 100% 15.000 21.000 N POLR2A n/a
2 TRCN0000021285 GCGGAATGGAAGCACGTTAAT pLKO.1 997 CDS 100% 13.200 18.480 N POLR2A n/a
3 TRCN0000330513 TGCGGAATGGAAGCACGTTAA pLKO_005 996 CDS 100% 10.800 15.120 N POLR2A n/a
4 TRCN0000021287 GCAGGACGTAATAGAGGTCAT pLKO.1 2529 CDS 100% 4.050 5.670 N POLR2A n/a
5 TRCN0000021288 CGACTTGAACTGCATCTTTAA pLKO.1 4122 CDS 100% 13.200 10.560 N POLR2A n/a
6 TRCN0000330511 CGACTTGAACTGCATCTTTAA pLKO_005 4122 CDS 100% 13.200 10.560 N POLR2A n/a
7 TRCN0000369723 ATCGGCCTGTCATGGGTATTG pLKO_005 1991 CDS 100% 10.800 8.640 N POLR2A n/a
8 TRCN0000330512 CTCATCGAGGGTCATACTATT pLKO_005 2440 CDS 100% 13.200 9.240 N POLR2A n/a
9 TRCN0000369724 TTAAGGAGCTCATCAACATTT pLKO_005 3770 CDS 100% 13.200 9.240 N POLR2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000937.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11044 pDONR223 100% 28.4% 28.3% None (many diffs) n/a
2 ccsbBroad304_11044 pLX_304 0% 28.4% 28.3% V5 (many diffs) n/a
3 TRCN0000475373 CCGCCCCATAATATCGCCTCATTT pLX_317 16.9% 28.4% 28.3% V5 (many diffs) n/a
Download CSV