Transcript: Human NM_000987.5

Homo sapiens ribosomal protein L26 (RPL26), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
RPL26 (6154)
Length:
528
CDS:
43..480

Additional Resources:

NCBI RefSeq record:
NM_000987.5
NBCI Gene record:
RPL26 (6154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000987.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428617 GACCGAAGCAAGAATCGCAAA pLKO_005 70 CDS 100% 4.050 5.670 N RPL26 n/a
2 TRCN0000421290 GAAGTACAACGTGCGATCCAT pLKO_005 162 CDS 100% 3.000 4.200 N RPL26 n/a
3 TRCN0000117403 CCCATCCGAAAGGATGATGAA pLKO.1 184 CDS 100% 0.495 0.693 N RPL26 n/a
4 TRCN0000117404 CCCACATTCGAAGGAAGATTA pLKO.1 110 CDS 100% 13.200 10.560 N RPL26 n/a
5 TRCN0000117402 CCAGGTTTACAGGAAGAAATA pLKO.1 255 CDS 100% 13.200 9.240 N RPL26 n/a
6 TRCN0000434021 GGGCAAATACAAGGAAGAAAC pLKO_005 438 CDS 100% 10.800 7.560 N RPL26 n/a
7 TRCN0000117405 AGTCCAGGTTTACAGGAAGAA pLKO.1 252 CDS 100% 4.950 2.970 N RPL26 n/a
8 TRCN0000117406 GACACTATAAAGGTCAGCAAA pLKO.1 221 CDS 100% 4.950 2.970 N RPL26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000987.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01428 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01428 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491407 ATACTTCTGGCTACTGGTCGTCCA pLX_317 77.7% 100% 100% V5 n/a
4 ccsbBroadEn_03218 pDONR223 100% 84.1% 98.6% None (many diffs) n/a
5 ccsbBroad304_03218 pLX_304 0% 84.1% 98.6% V5 (many diffs) n/a
6 TRCN0000471468 TGCCTACAGACGGAAAGGTACGAT pLX_317 100% 84.1% 98.6% V5 (many diffs) n/a
Download CSV