Transcript: Human NM_000994.4

Homo sapiens ribosomal protein L32 (RPL32), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RPL32 (6161)
Length:
2094
CDS:
78..485

Additional Resources:

NCBI RefSeq record:
NM_000994.4
NBCI Gene record:
RPL32 (6161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000994.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420775 TAAAGTTAGGTGACAAGTTAT pLKO_005 832 3UTR 100% 13.200 18.480 N RPL32 n/a
2 TRCN0000272383 CGAGATCGCTCACAATGTTTC pLKO_005 368 CDS 100% 10.800 15.120 N RPL32P18 n/a
3 TRCN0000007956 CGCTCACAATGTTTCCTCCAA pLKO.1 374 CDS 100% 2.640 3.696 N RPL32 n/a
4 TRCN0000007957 CCAGATCTTGATGCCCAACAT pLKO.1 230 CDS 100% 4.950 3.465 N RPL32 n/a
5 TRCN0000418334 ATTAAGCGTAACTGGCGGAAA pLKO_005 168 CDS 100% 4.050 2.835 N RPL32 n/a
6 TRCN0000007954 CAGGGTTCGTAGAAGATTCAA pLKO.1 206 CDS 100% 5.625 3.375 N RPL32 n/a
7 TRCN0000007953 GCATTGACAACAGGGTTCGTA pLKO.1 196 CDS 100% 3.000 1.800 N RPL32 n/a
8 TRCN0000272382 TGCTGCTGATGTGCAACAAAT pLKO_005 337 CDS 100% 13.200 6.600 Y RPL32P18 n/a
9 TRCN0000418166 TGCTGCTGATGTGCAACAAAT pLKO_005 337 CDS 100% 13.200 6.600 Y Rpl32 n/a
10 TRCN0000272381 TTGATGCCCAACATTGGTTAT pLKO_005 237 CDS 100% 10.800 5.400 Y RPL32P18 n/a
11 TRCN0000007955 GCTGATGTGCAACAAATCTTA pLKO.1 341 CDS 100% 5.625 2.813 Y RPL32 n/a
12 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 1394 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
13 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 1270 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000994.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01434 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01434 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465721 TGTTGTTCGTTATACTAAATGTCT pLX_317 95.5% 100% 100% V5 n/a
4 ccsbBroadEn_13168 pDONR223 100% 23.4% 23.7% None (many diffs) n/a
5 ccsbBroad304_13168 pLX_304 0% 23.4% 23.7% V5 (many diffs) n/a
Download CSV