Transcript: Human NM_000998.5

Homo sapiens ribosomal protein L37a (RPL37A), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RPL37A (6168)
Length:
2992
CDS:
32..310

Additional Resources:

NCBI RefSeq record:
NM_000998.5
NBCI Gene record:
RPL37A (6168)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000998.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117448 CGCCAAGTACACTTGCTCTTT pLKO.1 133 CDS 100% 4.950 6.930 N RPL37A n/a
2 TRCN0000333511 CGCCAAGTACACTTGCTCTTT pLKO_005 133 CDS 100% 4.950 6.930 N RPL37A n/a
3 TRCN0000369946 GATCGTCGGTAAATACGGGAC pLKO_005 58 CDS 100% 1.200 1.680 N RPL37A n/a
4 TRCN0000117447 GCCAACTGTAAACTTTAGTTT pLKO.1 593 3UTR 100% 5.625 3.938 N RPL37A n/a
5 TRCN0000117449 GCACTGTGGTTCCTGCATGAA pLKO.1 196 CDS 100% 4.950 3.465 N RPL37A n/a
6 TRCN0000333512 GCACTGTGGTTCCTGCATGAA pLKO_005 196 CDS 100% 4.950 3.465 N RPL37A n/a
7 TRCN0000117451 GCGGTGCCTGGACGTACAATA pLKO.1 228 CDS 100% 4.400 3.080 N RPL37A n/a
8 TRCN0000117450 CCATCAGAAGACTGAAGGAGT pLKO.1 276 CDS 100% 2.640 1.848 N RPL37A n/a
9 TRCN0000333449 CCATCAGAAGACTGAAGGAGT pLKO_005 276 CDS 100% 2.640 1.848 N RPL37A n/a
10 TRCN0000377347 TGAAATCAGCCAGCACGCCAA pLKO_005 118 CDS 100% 2.160 1.512 N RPL37A n/a
11 TRCN0000104212 GCCATCAGAAGACTGAAGGAA pLKO.1 275 CDS 100% 3.000 2.100 N Rpl37a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000998.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01439 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01439 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471130 CAGTTAACCCTCCGACACTTCCCT pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_15574 pDONR223 0% 77.8% 77.1% None 216_276delinsG n/a
5 ccsbBroad304_15574 pLX_304 0% 77.8% 77.1% V5 216_276delinsG n/a
Download CSV