Transcript: Human NM_001001850.3

Homo sapiens syntaxin 19 (STX19), mRNA.

Source:
NCBI, updated 2019-06-12
Taxon:
Homo sapiens (human)
Gene:
STX19 (415117)
Length:
1149
CDS:
245..1129

Additional Resources:

NCBI RefSeq record:
NM_001001850.3
NBCI Gene record:
STX19 (415117)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001850.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064973 GCACAACTTTCAGAGATTGAA pLKO.1 863 CDS 100% 5.625 7.875 N STX19 n/a
2 TRCN0000100921 GAGAAGGTTTAGTCTACTTAA pLKO.1 490 CDS 100% 13.200 10.560 N Stx19 n/a
3 TRCN0000064977 GCTGAGAGACACCTACATGAA pLKO.1 383 CDS 100% 4.950 3.960 N STX19 n/a
4 TRCN0000447192 AGAAGTGCAAGACATTTATTT pLKO_005 723 CDS 100% 15.000 10.500 N STX19 n/a
5 TRCN0000446549 AGTGGTCACAAGGATACTTAA pLKO_005 625 CDS 100% 13.200 9.240 N STX19 n/a
6 TRCN0000064975 CTACCATTACAAAGGAGATAA pLKO.1 519 CDS 100% 13.200 9.240 N STX19 n/a
7 TRCN0000064976 CAATGACACAATAGCAGCAAA pLKO.1 697 CDS 100% 4.950 3.465 N STX19 n/a
8 TRCN0000064974 GTCATGTATCAACTACAGAAA pLKO.1 306 CDS 100% 4.950 3.465 N STX19 n/a
9 TRCN0000448904 ACAGAAGTTTGAATGATTTAG pLKO_005 561 CDS 100% 13.200 7.920 N STX19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001850.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05664 pDONR223 100% 99.8% 100% None 744C>T n/a
2 ccsbBroad304_05664 pLX_304 0% 99.8% 100% V5 744C>T n/a
3 TRCN0000471044 TCTTTCGACTCATCCGAGCTAAGA pLX_317 38.2% 99.8% 100% V5 744C>T n/a
Download CSV